Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4233
Length(NT) : 786
Best Gene Model Blast : Link to GSTUMT00001777001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: sugar transporter family protein
Accession: ref|XP_001261499.1| Score: 676 E_value: 1e-77
KEGG Definition: sugar transporter family protein; K08178 MFS transporter, SHS family, lactate transporter
Accession: afm:AFUA_7G05550 Score: 673 E_value: 9e-78
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0255 Score: 207 E_value: 2e-17
PFAM Definition: Sugar_tr, Sugar (and other) transporter..
Pfam Number: pfam00083 Score: 245 E_value: 7e-22
Swissprot: P36035|JEN1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0005886 = Cellular component: plasma membrane
GO:0015129 = Molecular function: lactate transmembrane transporter activity
GO:0015727 = Biological process: lactate transport

Sequence:
>Contig4233
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCTTGGCTCTGCCAACCAGTCAAAGAATAGGAATCATGCCCCGAA
TGAGTGCAAGACAGTATGTGGCCACCCGCATCAGTACTCTCAATCCACCG
GGGAACATACCCCCCAACCCGATTACCGTCCTTCGCCAGTTGAATTGGAG
ACAGTGGCAATTTTTCCTAATAGGTTTCATCGGATGGACATGGTATATCA
CCCGTGTATCTCTCTAGCATGTGGGAATAACGGATGTATTAGGGACGCGT
TCGACTTTTTCTTAGTATCTATGACTATCACGTCACTTGCGAAAACGTTC
CATAGGTCCAAGGCCGACATCACATGGGGCATAACTTTGGTATTGATGTT
GCGAAGTGTCGGTGCCATCTCCTTCGGTATGGCTGCAGACAAGTGGGGAA
GGAAATGGCCGTTTATAGCCAATATCGTTTTGTTCATTATTTTGGAATTG
TCAGCTAGTTTCTGTAATACCTATGAGCAATTTCTGGGAGTTCGTTCCGT
ATTCGGTATTGCCATGGGGGGATTGTATGGTAATTGCGCTTCAACCGCTC
TCGAGGACGCACCCAATGAAGCTCGTGGTATACTCTCGGGCATGCTACAA
CAGGGTTATTCCTTTGGTTATCTTCTAGCTACAGTATTCGCTCGTGCCCT
TGTCAACACAACACCTCATGAATGGAGGCCCTTGTTCTGGTTTGGGGCAT
GCCCTCCAGTCCTGATCATTGCTTTTCGGTTATATC

Sequences in the Contig:

SY0AAC11YD24FM1 SY0AAC15YK08FM1 SY0AAC22YC06FM1
SY0AAC28YF11FM1 SY0AAC39YD17FM1 SY0AAC41YN13FM1
SY0AAC53YA01FM1 SY0AAC9YL20FM1 SY0AAD13YC06FM1
SY0AAD18YH02FM1 SY0AAD38YH19FM1 SY0AAD50YE17FM1
SY0AAD53YN17FM1