Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4232
Length(NT) : 1127
Best Gene Model Blast : Link to GSTUMT00001060001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_12988
Accession: ref|XP_001548593.1| Score: 776 E_value: 1e-80
KEGG Definition: hypothetical protein
Accession: mgr:MGG_07273 Score: 736 E_value: 3e-76
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0318 Score: 796 E_value: 2e-85
PFAM Definition: WD40, WD domain, G-beta repeat..
Pfam Number: pfam00400 Score: 114 E_value: 2e-06
Swissprot: O14301|YE85_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0051286 = Cellular component: cell tip
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4232
TTGGCAGACGGAGAGCACTTCGTCTCCGTGGGCACGGATCGCAAGATCAT
TTTGTACGATGGTAAAACGGGGGAGTTCAAGACCGAAATCGCCTATGGAG
ATGCCACCCATAGAGGAGGTATCTACTCAGTCTCTTGGAGTAAGGATTCA
AAGAGATTTGTTACCGCCTCAGCAGATCAAACAGTCAAGGTCTGGGACTT
GCAGTCCGAGAAGAACTCGCACACATGGAGGTCTGGGCCAGAGGGAACAA
GCATTCCTGACCACCAAGTTGGTGTCGTCTGGACACCCAGAGCTGACAAC
ACCATCATCTCACTGTCGCTATCGGGGGATCTAAACTACCTTGACCTGAA
CTCTGACCGGCCAAAGAGGGTAATTACTGGGCATCAAGCATCTATCGGCG
CAATGGCCGTCACTGGAGAGACAAAAACCTTGTTCACTGGAGGCGTAGAT
GGGAAAACCTGCGGGTGGGATCTGACCAAAGGAACTGCGGATTCACTGGA
TGGTGCAGGCCACACGAACAGTGTCTGCGGATTTTCCTCGCAAGACGAAA
GAAGATTGGCTTCGATCGGACTAGATGACTTTATAAGGCTTATTGATGTT
GGGGCCAAAGTATTCATTGGAACAAATCACCATTGTGACGCGCAGCCTAA
GGGGTTTACTTGGCTAACATTGAAGGGGGAGCAATTTCTGGTTACTGCAA
CAGAAAAAGGAATCCTTCTGGGTAAGGTTACCACCAAACTCAAAGTCAAT
GAGGTACTGCAACAAACCTACACCCCCACCCATATATCTGGCTGTCGAGA
TAAGGGTATTTTTGCCGTTAGTGCTGTAGACCAAACGATCCACATATATA
GCACTTATGAAGAGGGGCCGGGCGAGCAAAGGATTAGTGAGGGGAAAGTC
CTCAAGGACTTTCAGGCAGCGCCGACATGTCTTTCCTACTCACCCTCGGG
AAAGTATCTTGCGGTCGGGTTCTCATCGGGAAAGATCATCCTATACGATG
TGGACGAGGGCTACGCAGTGAAAACTACCCGTTGGTCATTTCACACGGCT
AGGGTGGCGAGTATCACCTGGAATGCGGAGGAAACCCACGTCGTCTCGGG
GAGTCTTGACACGAATATCTACATCTA

Sequences in the Contig:

SY0AAA47YI20FM1 SY0AAA60YA24FM1 SY0AAC28YE15FM1