Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4230
Length(NT) : 641
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: phosphoenolpyruvate carboxykinase
Accession: ref|XP_001596065.1| Score: 878 E_value: 1e-100
KEGG Definition: hypothetical protein ( (AY049067) phosphoenolpyruvate carboxykinase [Emericella nidulans] )
Accession: ncr:NCU09873.1 Score: 844 E_value: 9e-97
KOG Definition: No Hit Found
PFAM Definition: PEPCK_ATP, Phosphoenolpyruvate carboxykinase..
Pfam Number: pfam01293 Score: 627 E_value: 3e-66
Swissprot: Q7RVS9|PPCK_NEUCR

Sequence:
>Contig4230
TTGGCAAGACCGCTCTGCATCCAGGCGGCGTCGTCCCCGTCAAGGAGCAC
ACTGAGCTCGAGGAGGAACTACACGAGAAGGCACACATCGACTATGATCG
GGTTGCCATTGTGCCCAACCCCTCGGTTGGCAGCACTCTACGAAGATGCT
CTCGTCTACGAGACTGGCTCAGCCATCACATCTTCTGGTGCCCTCACTGC
CTACTCTGGAGCAAAGACTGGACGATCGCCTCTCGACAAGAGAATTGTGA
AGGAACCCGGATCGGAAAATGATATCTGGTGGGGACCTGTTAACAAGCCA
ATGACTCCTGATGTCTGGCGAATTAACCGCGAGCGTGCCATTGATTACTT
GAACACGAGAAATCGTATCTACGTCGTCGACGGCTATGCAGGATGGGACA
AGAAGTACCAGATCAAGGTTCGAGTCGTCTGTGCTCGTGCCTACCACGCT
CTTTTCATGCGCAACATGCTTATCCGACCGGAACGCTCTGAGCTTGAGCA
TTTCCACCCCGACTACACCATCTACAATGCTGGTTCGTTCCCGGCCAACA
GATACACTGAGGGCATGACCTCGGGAACGTCAGTCGCCATCAACTTCGCC
GAGAAGGAGATGGTCATTTTGGGTACTGAGTACGCGGGTGA

Sequences in the Contig:

SY0AAC28YE06FM1 SY0AAC29YI15FM1