Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig423
Length(NT) : 870
Best Gene Model Blast : Link to GSTUMT00004975001 E-value : 1e-57
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig423
TTGGGCCTCTTGAACATTGGCGCAATTACTTCCTTCAACGCATTCGATAA
ACTCTACAATACCGATAACAAGGGCAAGCACACTCCATCATCACCAACAT
TAATCCCAACCATCATCTCAACCTGCGACGAAGCTGAAAAGCAAATCACG
ACCTTCACAATGTACTCCTGTGTAAACCAACCCAGAGGATGCCGCGGGCG
AGTAAATATCTTCGGTGGACGATGCGATAGTTGTAGGGTTAGTTCTAGAC
AGACTCGGCCTTCCATGAGGCGGGCTATTTCTGCTGCTTCACCGTTACTG
ACATTCCTTTAGCAACTCAATCTCCGGAAGCCTTCAGTTTTCTCGACGCC
AAAGCTTTACCGAAAACCTTCGATAGACCTCTCGTCATTACACTCGACGT
TCCCTGAGTACGAGAGTCGGTAAATCAGGACTTTCGACCACTACTGCTAC
TATTCCAGCTACTACTACTGCGACTATTACCGACTAAACTTTATCCCTCT
TTCAATCATCCTTGGCCGAGAGTGGAATGTGGGGGGGAGAGGGGGGGAGC
GGAAGGAAAGGTTTATTCATACTCGAACGAAATTCATGACCTCGATCATC
TTGTTGCTTCAGCATCTGCGAGAATACGGAAAATGCAATCCACTGACGGA
ATCGGTGGGAGGCTCCTTCTGTCTGGCTCACGAGGGTAACATACATACAT
CGTCACGGGGCACCACAACCCAACAACGTCAACGAGCATAACCATTCATT
CATCCATACGATCCTCCTCTCGACTCAACCAACCTAGCCCCTCCCTCCCT
CCATCCCCCTCTTAGCACAGCACACCTCACCCTGCCGGAAAAAGCAACAA
AAGCAAATTCCCCCCAATTT

Sequences in the Contig:

SY0AAA23YK21FM1 SY0AAA60YP05FM1 SY0AAA63YD05FM1
SY0AAB20YA11FM1 SY0AAB3YL09FM1