Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4229
Length(NT) : 1704
Best Gene Model Blast : Link to GSTUMT00004188001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: gamma-glutamyltranspeptidase Ggt1 (PMID 15052323)
Accession: ref|NP_593457.1| Score: 972 E_value: 1e-103
KEGG Definition: hypothetical protein [EC:2.3.2.2]; K00681 gamma-glutamyltranspeptidase
Accession: spo:SPAC664.09 Score: 972 E_value: 1e-103
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2410 Score: 1231 E_value: 1e-136
PFAM Definition: G_glu_transpept, Gamma-glutamyltranspeptidase..
Pfam Number: pfam01019 Score: 1046 E_value: 1e-114
Swissprot: Q9US04|GGT1_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0003840 = Molecular function: gamma-glutamyltransferase activity
GO:0006995 = Biological process: cellular response to nitrogen starvation
GO:0006751 = Biological process: glutathione catabolic process
GO:0006980 = Biological process: redox signal response
GO:0030503 = Biological process: regulation of cell redox homeostasis

Sequence:
>Contig4229
TTGGGCAGCACCTCTTTCTCTCCCTCGCTCTTTCCTTCCCCGCCAAACAG
ATTCTTCCCCTCCAATATTTCAAGGTCCGACAATGCCCCCAAACAAAGTT
CGCTTCTCACCCACTGTCTCCCGTTCCCACACCCCACCGCACTCGCCTTC
GCCAACCCCCTCCAGCTCATCGATCCTCTACAACACCGATGATGACCAGG
ACTCCGACGACGATGATTCCGTACGCCGGAACCTCCTTCCGACAATTGCA
CGACCATTGGTACGCCGTCGCAGACGGCTGGGTAAGCGGAATGCATGGAT
GAAGTTTGGGATGACGGTCTTGCTGGCCGCAGCTTTACTAGGTCTAGGAG
TTTTGTTCGGGGTTATCTTTTGGGAGAATGAGGAGGGGATTGTTGATGAT
GGAATTCTGGTGGATGCGCCGAGGGGGGCGGTTAGTAGTGATGTTCTTAC
CTGCTCAAGAATTGGCGTGGAGCTTTTGAAGAAGGGCGGGAATGCAATTG
ATGCTGCTATCGGGACCGCGGCATGCATTGGGGTTGTGAACAGCTTTGCC
AGCGGCATCGGCGGTGGGGGGTTCATGGTTGTACGCGAGGGTGATGGGCG
ATCTAAAGCTTATAATTTCAGGGAAACAGCGCCGGGGAGTGCTTCCCGGG
ATATGTACAGTGGTGATCCACTGAAAGCACGGGTCGGCGGTCTCGCAGTA
GCAATCCCCGGAGAGGTCCACGGGTATGCTACGGCACATGCCCGGTCTGG
CCGGCTACCCTGGCAAGAGATTTGGCAGCCGTCGATAGACCTGGCAAGAA
GGGGTTTCCACATCCCGCCGATGCTGGCGGGAATCATGGCCAAGGAGGCG
CCGTTCTTTCGACAGCATAGGGAGGAATGGGAATTTTTGTTCAGTCAGGA
AACCGGTGAGCTCTTACAAGTTGGAGAGCTTATGAAGAGGGAGGCGTACG
CACGCACGCTCGAAGTTATTGCCGGCAAGGGGGAGTATGCTCGCGGTGGG
GTGTATTCCGGAGTGAAGCAATTCTATAACGGAAGCATTGCGGAACGAAT
TGTTGAGGCTGCAAACAAGCATGGTGGTATATTGACTACCGAGGACTTTT
CGAGGTATTTTACGATCGTCGAGGATACGGTCAGAACACACTTTCACGGA
CGGGAGGTTATTACCTGCCCACCCCCTTGCAGCGGGGCCGTATTGATCGA
GGGATTGAATATCGCTGAAAAGCTGGACATGAGCGATCCCGATAAGTCAC
TATCGTACCATTATTTAGTGGAAATAATGAAGTGGATATCCGCAGGGCGC
ACCGAACTGGGAGATCCTGCGGACCCGGTGGTAGCGTCCAATTCCAAGAG
GATACACCAACTGCAAAGCAAATCCTACGCGGAAGCTGTTCGGGCAAACA
TATCCGCTGACACCACCTACTCGTGGGAACACTACAATCCAGCGTACGAG
CCAGTAGATCCCAAAGGAACCTCGCACCTATCCGTGTTGGACAATTACGG
GAATGCCGTAGCCCTCACCACCACCGTGAACCTGTACTGGGGCGCCAAAG
TTCATGACCCACAAACCGGGATCGTCCTAAACTCGGAGATGGACGACTTT
TCCATCCCTGGTCGCTCAAACGCGTATCGTCTCGAACCGTCCATATATAA
CTACATCATCCCCTACAAGAGGCCGTTATCATCCACCACTCCCACCATCA
TCGT

Sequences in the Contig:

SY0AAC28YC22FM1 SY0AAC34YF12FM1 SY0AAC39YL03FM1
SY0AAC3YG01FM1 SY0AAC47YP20FM1 SY0AAC9YN02FM1
SY0AAD11YE12FM1 SY0AAD20YF11FM1 SY0AAD31YI20FM1
SY0AAD42YD17FM1 SY0AAD44YM02FM1 SY0AAD45YL23FM1
SY0AAD52YD17FM1 SY0AAD56YC24FM1 SY0AAD56YN13FM1
SY0AAD61YE08FM1