Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4227
Length(NT) : 773
Best Gene Model Blast : Link to GSTUMT00003160001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: TATA-binding protein
Accession: gb|AAY23352.1| Score: 730 E_value: 2e-75
KEGG Definition: hypothetical protein
Accession: ang:An16g03940 Score: 724 E_value: 4e-75
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3302 Score: 511 E_value: 1e-52
PFAM Definition: TBP, Transcription factor TFIID (or TATA-binding protein, TBP)..
Pfam Number: pfam00352 Score: 309 E_value: 3e-29
Swissprot: Q12731|TBP_EMENI

Sequence:
>Contig4227
TTGGCATTACATCAACTTACCCTCCCGTCAACTCCACACATCCGAAGCCT
TTTCCTCAACCATCCGCAACCTCATCAACCGCTTCGTCCATCAAAAAACA
ACAACTTCCATTATCGATCTTAATCATGGCGGCTATTATTTCCCACCCCC
AGAATGCCCAGCAAGCCAAGGCTTTCACTAGCCCCGCTTCTTTGTCTTTT
CCCGGTGGTGCTGGCGACTTGACTCCTCCATCCGACGTGGAGAGTCATAA
AGCCCAAATGAACGGGCAGCAAGTCAACGATCAGTCCGGAGGAGTTGTTA
CTCCCGCGACCCCGGCTGCAACCCCAGGTGGTGGACCAACCGTTAGTGGT
ATTGTGCCTACATTGCAGTGAGTACTACCAAATTATAACCGGTTTTGATT
CATCAAGCTTAACTGGTATGCGTAAAGAAACATCGTCGCAACCGTCAATC
TTGATTGTCGATTGGATCTGAAGACGATTGCCCTGCATGCTAGGAACGCA
GAATACAACCCCAAGCGTTTCGCCGCTGTTATCATGCGTATTCGCGAACC
TAAAACCACTGCACTCATTTTCGCATCCGGCAAGATGGTTGTCACCGGTG
CCAAATCTGAAGATGATTCCAAGCTCGCCTCGCGCAAATACGCTCGCATC
ATCCAAAAACTTGGGTTCAATGCTAAATTCACGGATTTTAAGATCCAGAA
CATTGTTGGCTCCTGTGATATCAAGTTCCCCATTCGCCTCGAGGGTCTCG
CCTCTCGCCATCATCACTTCAGC

Sequences in the Contig:

SY0AAC28YB15FM1 SY0AAD32YE05FM1