Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4226
Length(NT) : 730
Best Gene Model Blast : Link to GSTUMT00003887001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4226
TTGGCATCTTCCTGGGGGTCATCTGCGCTCACACTTCCTTGGCGATCAGA
TAGACCTCAGTTACGCTTGAATTTGTCGGAATACCAAACTGGCTCTTTGA
TCCTGCCTTCACTGCGCTTCCTTCCGTCTCTCCCGTTGAGTTCCTCCGGT
ACTGGTCTCCCGCTAGTCAACCTCCGGAACCCAAAAATACGGAAAAAAGG
GAGGTTTGCGACAACCCCAGATCACAGCACAATCGACCAGGGGCAGAGGG
AAAAGCTTTCGGTTCTGTGTGGTACTAACCGTTCACCCCTCTGGTCCTAT
GGCCTTTTCAACTTGAACATGAACTCCCTTAGCATACTCTCGTCTCGAGT
CGACAAAGTTATTGGAGCAACGACTCCACCGGCTACTCAACGGACAGATC
CTTTTAAACCTCTACGTCGTGGGCAGCGCTCTGGCTCTTTGAGGTCTTTT
GAGGATAGGGGGTATCAGCCGAAGAGGGACCTCAAGCAAAGCGTTTGTTA
TGATGACGATGGAGATGGCGACGAAGAAGAAGTGGAAGAGGAAGATGGGC
CAGAAGACTATGAGGAGGACGAACACGGTGATTTATTACTCGACAAGGGC
CAGCGATCTGTAGGGTACGGGATGTGGCTATTGGGACCATGGCTAGGGGC
ATTCCGGTGGTTTTTCTCAACATTGTCTTCTTCGGGAGGCTGGCTGATAT
CCTTTTTGTATAATGACGATGGTGTCTTTT

Sequences in the Contig:

SY0AAC28YB08FM1 SY0AAC40YM17FM1 SY0AAD58YP05FM1