Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4225
Length(NT) : 614
Best Gene Model Blast : Link to GSTUMT00002412001 E-value : 1e-146
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4225
TTGGCAACCATAAACCCGCCCACCTCCATCACCAGTACACTCCTTCGCTC
ATCCTACCCCCCCACCCCCCTCTTCTCCACCTGACTGGTCCAGTCATCTC
ACGCTCTTTCATTGATTACTTTCTTCCTCGCCGTCGGACGGGTTCCTTCG
TTTCCTTTCCCTTTCCCCTTCCTTTTCCTTCCTCCCTCCCTCCCGCTCCC
CCCTTCATAGCCCCACATTCATTTTAGTAGATCTTGAATCTGCGGCCGCT
CTCTTTTTTCTCCTGTTTTGGCTTCTCTTTTTACCGTTCCCCCATTTTTA
ATCATTCCTGCCCGAACAGAGACTCGGAAGCCCAACGACATTCTTGACCA
GTCATGACTTTGCCGCGCTCGCTCCTCTCCATGTTGCCGCTCGTCCTACT
ACTTTTACTTCAATCACTCACTGCATCCGCAGCTTATGTTCCAGGCCCAG
GTCACGATCTCTTCGCACGACAAAACCCCAACTGCGTCAAGGACTGTCTG
GTTCCTCCGTGCGGTGGATGTGCTCCGAATCAGTACTGCGCTCTAAGCGT
TCAGACGTGCGATGCTTGTCCAAAGGCCACCTGTGCCAACATTCAGAGTG
GCGGCGGCGACAGC

Sequences in the Contig:

SY0AAA43YN23FM1 SY0AAA56YM22FM1 SY0AAA58YL12FM1
SY0AAA7YA22FM1 SY0AAC15YD10FM1 SY0AAC28YB04FM1