Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4224
Length(NT) : 512
Best Gene Model Blast : Link to GSTUMT00005070001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_03253
Accession: ref|XP_001243812.1| Score: 490 E_value: 4e-48
KEGG Definition: extracellular protein SEL-1 and related proteins; K07126
Accession: aor:AO090003000492 Score: 476 E_value: 1e-46
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis, Posttranslational modification, protein turnover, chaperones, Signal transduction mechanisms].
Kog Number: KOG1550 Score: 265 E_value: 2e-24
PFAM Definition: No Hit Found
Swissprot: Q9UBV2|SE1L1_HUMAN
Gene Ontology:
GO:0016021 = Cellular component: integral to membrane

Sequence:
>Contig4224
TTGGGTGGAAAGTTTTTGTTATATGCTTGGGGCTAATTGAGATTTAGGGG
GATGCAAGTTCGCAAAACGGCCTCGGATTCATGTACCTCCATGGGTATGG
TGTCAAAGTGGATCGTTTGAAGGCGGCTGAATTCTTCCAGACTGCCACCG
AACAGGATCTGCCTCAGGGCCAGATTAATTTGGGCAAGATCTTCCTGGAG
CAGAATGACATCGACACTGCCAAGCGCTTCTTCGAACTTGCAGCACGTCA
TGGAACTCTCGAGGCTTACTACTTCCTTGCCGAGATTTACAACTCTGGAC
TCGGGAAAGAGCGTTCCTGCACGCTGGCGACGGCCTACTACAAGATTGTT
ACGGAGAGGGTCGAACCACTTCATAGCCCGTTAGCCTGGGCCAATAAGGC
GTATGCCGGCGGGGATAAGGAGAGTGCTATAATCGGGTACATGATGGCTG
CTGAGCAGGGTTACGAAGCCGGACAGGCAAACGTCGCATTCCTACTTGAC
CAGGAAAAGTCG

Sequences in the Contig:

SY0AAA6YA20FM1 SY0AAC28YB02FM1