Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4223
Length(NT) : 2123
Best Gene Model Blast : Link to GSTUMT00000199001 E-value : 0.0
Numbers of ESTs : 81

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001245032.1| Score: 1624 E_value: 1e-178
KEGG Definition: hypothetical protein
Accession: ang:An12g00790 Score: 1562 E_value: 1e-171
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0548 Score: 1507 E_value: 1e-167
PFAM Definition: No Hit Found
Swissprot: Q60864|STIP1_MOUSE

Sequence:
>Contig4223
TTGGTTCTTTTTCTTTTCTTTCTTCCCCTATTCCACTCTCGATAGTTCCA
TCCCTCCGGAGAATACAATTTACAGCTCTGTAACTTGAATTCTAATACTT
CGGAAAATCACTAAGCAATATGTCTTCCGACAAGCTTAAAGCCGAAGGAA
ACGCGGCTTTTTCTGCGAAGGATTTCGACAAGGCCATCGGCCTCTTCACC
CAGGCTATTGAGGTTGATCCTGAAAATCATGTTCTCTTCTCGAATCGTTC
CGCATGTTACGCTTCTATCAAAGACTTTGACGGTGCCCTGAAGGATGCAG
TCAAGTGTATCGAAATAAAGCCGGACTGGGCCAAAGGTCACACTAGGAAA
GGTGCCGCTCTCCATGGCCAAGGCGATTTAGCTGGAGCATTGGAAACCTA
TGAGGACGCCCTAAAACTCGACCCGAACAACCCGCAGGCCAAATCTGGAG
TAAAGACCATACAGGAGGCTATCGCTCGCGACAGCCATCAAGGCGCAGAT
CTCGGCATGGGAAACCTCTTCAAAGACCCACAATTTTTGGAAAAGCTCGC
AAGAAATCCGAGGACTTCAAGCTACCTTGAGGATGTGGAATTCATGGAAA
AGCTAGAAAGAATCCGTGACGACCCTAACCTTATCCAGACCGAGCTGCGC
GATCCAAGGATCATGCAGGTCATCGCGGCCCTACTGGGGCTCCAGATGGA
AATGGGTGACAGTCCTGGCGGGCCAGGGGGGGCTAGCGGATCCTTTGGGG
ACACAGAAATGCCAGACGCATCCGGGGCTCCACCGCCAAAGAAAGCTGCG
ACTCCGCCTCCAGAGCCAGAGGACGAAGAGGCCAAGGCTAAGAAGGAGGC
TAAGGAGGCAGCGGATAAGGAGAAAGCGCTGGGTAATGAGAACTACAAGA
AACGCAACTTTGACGCTGCTATCGAGCACTATGACAGAGCGTGGGAATTG
CACAAGGATATCACATACCTCAACAATCTCGCTGCCGCCAAATTTGAGGC
AGGCGACTACGAAGGCTGCATAAAGGAGTGTGAGAGGGCTATCGAAGAAG
GTCGTGAAATCCACGCCGACTTTAAACTAGTCGCAAAAGCCTTCGGCCGT
ATCGGCACCGCCCACCAAAAACTTGAAAACTACCCCGCAGCAATAGATTA
CTACCAACGCTCTCTCACAGAACACCGCACGCCCGAAATTCTCCAGAAAC
TCCGCGCGGTCGAAAAGTCCCAAGCAGACCGCGATCGTGTCTCCTACATC
GACCCGGAGAAGGCCGAGGAAGCGAGAGAAGCGGGTAACGCATATTTCAA
ATCTGCAAATTGGCCTGATGCCGTTAAGTCCTACACGGAGATGATCAAGC
GTGCACCGGAGGACCCGCGCGGGTACACCAATCGCGCAGCGGCCCTGACC
AAGCTCATGTCTTTCCCGGAAGCTGTCAAGGACTGCGACGAAGCCATTAA
GCACGACCCGGGCTTCATGCGTGCGCACATTCGAAAAGCCCAGGCCTGCT
TTGCCATGCGCGAGTACAACAAGTGCCTCGAAGCGTGCAATGCGGCGACA
GAAGCAGACACAGAGAGCAAGCACACCAGGGAAATAGAGGACCTCACCAG
AAAAGCCATGCAAACGATGTACTCTGCTCGCGAAGGCGAGACCGAAGAGC
AGACAATGGAGAGGATTCAAAAGGATCCCGAGATCGTCGCCATCATTTCC
GACCCCGTCATGCAGAGCATCCTACAGCAAGCTAAGAGGGACCCTGCCGC
GCTTACCGAGCATATGAAGAACCCGGTTGTCAGGGGGAAGGTGCAAAAGT
TGATGGCTGCCGGGATTATTAGGATTGGCTAGTTGGTTGGATGGTTTGTG
AGGGAGGGATTTGTGATTCCGTTTTACTCTTTCTTCTTTCCTTCATTTTT
TTTCCCCTTAGCACTATAGCCAAGGTTAATACTTGATTGATTGATTGGTC
GGGGATTGATGTATACACATTCGGTTCAGTATTTTCCCGATATTTATTCA
CTTGCACTACCGCTTTTGTTTGCAAGACCGGTGCAAGTTAGTATTATACC
GTGTGTCATCGGGGTCCGATTCATTTTACCACATGATAGCTACCGTGATA
TTTCTAACCCTTTCTTTCTCTTG

Sequences in the Contig:

SY0AAA10YP02FM1 SY0AAA11YI12FM1 SY0AAA14YL12FM1
SY0AAA16YF12FM1 SY0AAA20YE19FM1 SY0AAA20YE19RM1
SY0AAA21YE04FM1 SY0AAA21YH08FM1 SY0AAA22YG15FM1
SY0AAA27YA08FM1 SY0AAA27YI18FM1 SY0AAA28YD13FM1
SY0AAA29YF10FM1 SY0AAA30YL14FM1 SY0AAA30YL14RM1
SY0AAA35YE06FM1 SY0AAA39YF10FM1 SY0AAA41YC10FM1
SY0AAA41YE24FM1 SY0AAA41YG03FM1 SY0AAA42YC06FM1
SY0AAA44YK24FM1 SY0AAA52YF21FM1 SY0AAA53YP02FM1
SY0AAA54YG23FM1 SY0AAA55YM15FM1 SY0AAA57YL13FM1
SY0AAA58YB16FM1 SY0AAA58YG18FM1 SY0AAA59YF11FM1
SY0AAA59YF13FM1 SY0AAA5YA19FM1 SY0AAA60YN07FM1
SY0AAA63YC24FM1 SY0AAA8YO23FM1 SY0AAA9YG04FM1
SY0AAB10YF07FM1 SY0AAB10YM06FM1 SY0AAB11YC09FM1
SY0AAB11YL10FM1 SY0AAB11YO13FM1 SY0AAB15YL15FM1
SY0AAB21YB14FM1 SY0AAB22YL20FM1 SY0AAB23YM17FM1
SY0AAB26YE07FM1 SY0AAB26YH19FM1 SY0AAB28YI10FM1
SY0AAB2YP17FM1 SY0AAB31YE03FM1 SY0AAB32YF24FM1
SY0AAB33YA19FM1 SY0AAB36YD06FM1 SY0AAB37YJ20FM1
SY0AAB37YM04FM1 SY0AAB40YK20FM1 SY0AAB41YA02FM1
SY0AAB41YI18FM1 SY0AAB43YL17FM1 SY0AAB43YN09FM1
SY0AAB47YO01FM1 SY0AAB48YI11FM1 SY0AAB48YI20FM1
SY0AAB49YL01FM1 SY0AAB52YM16FM1 SY0AAB54YL01FM1
SY0AAB58YN24FM1 SY0AAB59YB09FM1 SY0AAB61YB09FM1
SY0AAB61YM07FM1 SY0AAB8YC10FM1 SY0AAB9YI08FM1
SY0AAC11YL09FM1 SY0AAC18YI19FM1 SY0AAC20YP14FM1
SY0AAC25YN20FM1 SY0AAC28YA22FM1 SY0AAC43YD13FM1
SY0AAC8YA04FM1 SY0AAD17YO01FM1 SY0AAD39YK03FM1