Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4222
Length(NT) : 1182
Best Gene Model Blast : Link to GSTUMT00011130001 E-value : 0.0
Numbers of ESTs : 21

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001249186.1| Score: 782 E_value: 3e-81
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4222
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCTCACCCCTTCTCAACTCA
ATCCCCTCCTTCTCGACTCAATCCACCCCTTCTCAACTCAACGTCACGTC
TGAACTAGTGATAACCACCAAAATACGCAATGGCCTTTTCTCGCTCCGCC
CTACGCAATACTCATTTTTACGATGCCACCAATCCCGAGGTGGTTTTGGG
AGGTTTTCGTCAAAACGGTTCTATAACGGAAGCAAACTTTCTTTCTTTCC
TCGACATCCTGCTTGTGACTCAGGAGCGTACTGTGCGTGTTCAGGAAAGG
ATTTCGGGCCACGTTGTCACTAGAACCAACACTCCCCTTGCAACTGGAGC
GTACGTTATATATTGTGATGGCCGTATCGAAATTAGCAATGAGCGTTCGG
TGCACCGGCTTTTTTCTCGCAGCGTCTCCGGCAAGGAGACTAGATTCCGC
GATGAAATCCGCGCTCGTGACCGGAAATGCGTTATATCTGGCATGATAAA
TTCTGACCTTAGTATCCAAGCTTCGGACTGGGTTTCTTTCGAGGCCGCTC
ATCTCTTCCCTCTCCACGGCGAAAGTATTTGGATTGATTTGGATTTTGGG
CGATGGATCACAGATATGGACGATTCTCCACCATCCTCGAAGATCGATTC
GGCCCAAAATGGGTTTCTTCTCCGGTCGCATATCCACCAACTGTTTGATC
AGTACCTAATCTCCGTTAACCCTGAGGATGGCTACAAAGTAGTTGTGTTT
AACGGCAATGTTGATGGGCTTGATGGTAGGATTCTCGATCCCGTGTGCAG
AGACCCGGCCAATCCTCACTGCGTCTCCGACAAACTTCTAAGGTGGCACT
TCCGCCAATCAGTTCTCGCCAATGTCAGAGGAGAAGGGGAACCAATCTTC
GAGCACGATTTCCCACCAGGAACAGACATTATGGGTGAGATCCTTGCAGG
TCCGTGTGGGCAAGAGAGATTGGAGTTGGAGATGGCCGCTCGACTGAGAG
GAGTTTGTTAAGGGTAACTTCTGCGATTGCGATGTGATGGTGCAATTGTC
GAGATTTCGATACTGGCGGAGTTATTACTACTAGTATGTGGAGGCCGGAG
ACAACTCTATATGTTTGAAAGCATGAAAGCATTGTAGGGGGGATTGGTTA
GAGGGGGCGCAATAAAAATATGATTGAATTAG

Sequences in the Contig:

SY0AAA16YH01FM1 SY0AAA22YI01FM1 SY0AAA26YM05FM1
SY0AAA28YI18FM1 SY0AAA39YN04FM1 SY0AAA54YK21FM1
SY0AAA57YF16FM1 SY0AAB15YA04FM1 SY0AAB44YE01FM1
SY0AAC13YO12FM1 SY0AAC17YM01FM1 SY0AAC27YO20FM1
SY0AAC28YP02FM1 SY0AAC28YP02RM1 SY0AAC29YC06FM1
SY0AAC30YH02FM1 SY0AAC49YO24FM1 SY0AAC53YD11FM1
SY0AAD22YB14FM1 SY0AAD39YK23FM1 SY0AAD63YH06FM1