Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4221
Length(NT) : 806
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4221
TTGGGCTCTTTTCCCTGTTCTTCCCAATTGTTCACCCGTCCCTTATTCTG
GTGCCCGCCCTCCTGCTTTCTCTCCTTCTGACTCTCCCTCTTTCCCTTTC
CCTTGTCCCAGCTTTCAGCTTTCTTGTTGCTTGCGCCCTTCTCCATCCCT
CCGGTGCCTTTCGTTCTCCTCCCCAAGTCGCTCGTTTCATTCTCTCCCCC
ATAAACCCCCACCCAACACCAGAATTGCACATTGGTTGTGATCTGTTCCC
TTTGCCAAGCTGTCTTCCCGCCGTTTCATTATTAGCTTTGTCCGGTCCCA
CACAACAAAGGAACAATTCACATCCGCCCTTAACTCTCGCTCTTGTTTTG
TCTTCTTTTATCCGGATTGCGGAAGACGCACTTGTTTACCGCCCAGATAT
TTGACACGACAACTCCACCCTCGCTCGTTTGGTTAGGGGAACTAGGGGGT
TCGAGAAGGGGTCTAGGACACACGATACTGGTGCCTGGTGGCTCCAGGAG
CCCAAATAATCTTCCAACTGCGAATTCATCATCGACTTCGACCTCCTCAA
TCTCCGCTGACGGGGCTCCCTTATTCCGGTTATTTCCAGAGCCACTCAAC
ACTATAGCCCTCCTTCCTCCTTTGGGGCAATTGCCCTTACCACCTGTGCC
CTCTTCAGCTCACCAATCGTGAGATCGTCGGGAACTCCCGCCCATCACCA
ACCATGCGACAATCCCCAATGGCAACCCTACGCCGCCTATCTACATCGCT
GCTATTACTATCGCCCCTAATTGCTGCCTATGAACTCGACCTTGATAATA
AAAAGT

Sequences in the Contig:

SY0AAA20YG18FM1 SY0AAC21YP01FM1 SY0AAC27YN08FM1