Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4220
Length(NT) : 858
Best Gene Model Blast : Link to GSTUMT00006364001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein NCU08811
Accession: ref|XP_961998.1| Score: 736 E_value: 4e-76
KEGG Definition: hypothetical protein
Accession: ncr:NCU08811.1 Score: 736 E_value: 2e-76
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0706 Score: 556 E_value: 8e-58
PFAM Definition: ArfGap, Putative GTPase activating protein for Arf. Putative zinc fingers with GTPase activating proteins (GAPs) towards the small GTPase, Arf. The GAP of ARD1 stimulates GTPase hydrolysis for ARD1 but not ARFs..
Pfam Number: pfam01412 Score: 341 E_value: 6e-33
Swissprot: Q10367|YDBH_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus

Sequence:
>Contig4220
TTGGCGCGCATTTTCTGTCTCCCCTTTTATCCTTTTTGTCCTGACCCGAT
TATACTCCGGTACCTGCTTCCACGACCACCATGAGTTTGGCATCTAAAAC
CGAAGGCCAAAAAATCTTTGAGAAGCTCAAATCAAATCGTGCCAATAAGG
TATGCTTCGATTGTAACTCCAAGAATCCAACTTGGTCTTCCGTTCCGTTC
GGTATCTACCTGTGTCTCGACTGTAGTGCTCACCACCGTAATCTTGGTGT
GCATATATCTTTTGTCCGGTCTACCGTTCTTGATCAATGGCAATGGGATC
AGTTGAGGCTCATGAAAGTCGGTGGTAACGAATCTGCGACCAAGTATTTC
CAGAGTCATGGCGGGTCTGCAGCATTGGCATCCAAGGATCCCAAAGTCAA
ATACGGATCCAACACAGCTACCAAGTACAAAGAAGAACTTAAGAAACGTG
CAGCCGCAGATGCACAACTTTATCCCGCAGAAGTGATTGTTGAAGGTGGC
GAAGAAGTTGCTGTCCCTACTGAGGCTGAGGAAGATTTCTTTTCTTCCTG
GGATAAGCCTTCCATCAAACGTCCAACACCCCCACCGTCTAGAACTGCTA
CCCCACCGGTGGTTGGTAGGACTGGAACTCCTTCAAATGGCAGTGGCATT
GCACGAGCCAAGTCCCCCCTCGCTTCCCCTGAGACTGCGCCGGCCGTTTC
TCGTACCACGACCTCCTCTGCCCTGCGAACGAAGGCCGGTGCAACATCTG
CAAGTGGACCACGAAGGACAGGCGTATTAGGAGCCAAGAAAGGGCAAAAG
CTTGGGGCTAAGAAGGCCACTGGTGGGGATGTAATTGATTTCGATGAGGC
CGAGAAGA

Sequences in the Contig:

SY0AAA35YM18FM1 SY0AAA36YM01FM1 SY0AAA42YM02FM1
SY0AAB61YK02FM1 SY0AAC27YM23FM1 SY0AAC37YL23FM1