Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig422
Length(NT) : 1506
Best Gene Model Blast : Link to GSTUMT00011392001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SS1G_08931
Accession: ref|XP_001590167.1| Score: 588 E_value: 1e-58
KEGG Definition: hypothetical protein
Accession: ncr:NCU01455.1 Score: 508 E_value: 1e-49
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2376 Score: 452 E_value: 2e-45
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 131 E_value: 3e-08
Swissprot: O76094|SRP72_HUMAN

Sequence:
>Contig422
CCAAGTGACAAACTGTGCAATCCCTTCCTACCCGAGTGTGGCTTTTCCAC
ACCAACTAAACCTAAACCAGCAGCCACACGTGTCCAACTTCACCCCTCCA
TCCCACCATCCAACCGGACACCATCAAAATCCATCCACAAACTTCCCCAC
CAACCCGAGAATGTCACAATACACCCCAGCAACACTAGAATCCCTCCTAT
CAACCCTATCAATAACCGGCGATGCCGACCACGCCTCTGTCCTGAAGCAT
GCGAACAACGTCCTCAAGTCTGAGAAATCACACAAGCGAGCATTGCATAC
TAAGGCAGTAGCGCTGATAAACCTCGACCGCTACGAGGACGCGTTCTCCG
TGCTTTCGGTGCCGGAATTGGCAGGCGAGGCGGTGCTAGAGAGGGCTTAT
TGCCTTTATAAGTTGGGGAGGTTGGAGGATGCGTTGGCGGCTGCGGTGGA
GGGCGCTCGGAGCGGTGGGAGGGATGAGAGGGGGTTGAGGCATGTTGAGG
CTCAAGCTGCATACAGACTGGAAAAATTCGACCAAGCGGCGGGGATATAC
GCAGGACTATCCAGGGGCGGGTACCAAGCGGAGAACGAAGACTATGATAT
GAGGGTCAACATCAGCGCCACGAACGCACAATTGATTTGGGCGAACGGAT
CAGCGACAGCGGGGGGAGATAACAAGGTTGACAGGAGCGCTCTGGATGCG
TTCGAGACAGCGTTCAATTCCGCATGTGGAGCTGTTGCCCGGTGCGCGTT
CGGACAGGCACTTGTTTTACTAAAGAGGGCGAGGGAGTTGGGGTTGCTAT
TGGAGGACCTTAGCGAGGAGGAGAGGAAGGCCGAGGTTGCGCCGGTTCTA
GCTCAAGAGGCTTATGTGCTTGCGAAGATGGGAAGGTGGGAGGAGGCGTT
GGAGAGGTCGAAGGAGCTGGATGTCCCTAGTATCACCGACACTTCACTCA
AAGTCGTCGCTACAAACAACGAGATCGCTATAACCTCTCGACTGCCAGAC
TACAACCCCCATTTGTCACTCATCGCGTCGGCCGAGTTAGCTACCACATC
CGCCTCCTCAAAAGCATTCCTTTTTCAATCAAGGATACTTGACAGAAACC
ATGCAGTGCTGGAACTAGAAGCCGGAAAGACCCAAGCCTCAAAGAAACAG
GCTCTAGCGCACCTAAAAAATTACCCCCACGACAACGAGGCAAGTGTAAT
CCTAGCCGCCGCCCGTGAGGGCAAAGTCGAGAAGCTAGTTAAGAAGAGCC
CCGGCGACCTCGGCCTCTCATTGACTCTCGCACAATTGTGTATGCGCAGT
GGGAATATCACTGGGGCTATTGCCGCAGTAGAAAATGTTATATCCGCTGC
CGCGGAGGACCAAAAGTACCTCCCGGGTGTGATCGGCCTACTCGTTGGAC
TTTACCAGCACCAAGGCAGGTGTCAACATGTCAGAGACATCCTTTCGAAA
GCCAGTGAACACTGGAAGAACTCCCCGACTCCCAACCACCCCCTCCTCCG
CGCCTC

Sequences in the Contig:

SY0AAA10YA08FM1 SY0AAA23YK13RM1 SY0AAC31YD05FM1
SY0AAC40YK12FM1 SY0AAC58YD05FM1 SY0AAD39YP22FM1
SY0AAD6YG07FM1