Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4219
Length(NT) : 880
Best Gene Model Blast : Link to GSTUMT00004360001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_08469
Accession: ref|XP_001590729.1| Score: 918 E_value: 3e-97
KEGG Definition: hypothetical protein
Accession: mgr:MGG_07077 Score: 876 E_value: 1e-92
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG1386 Score: 553 E_value: 2e-57
PFAM Definition: GDA1_CD39, GDA1/CD39 (nucleoside phosphatase) family..
Pfam Number: pfam01150 Score: 492 E_value: 2e-50
Swissprot: P40009|YND1_YEAST
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0016020 = Cellular component: membrane
GO:0005792 = Cellular component: microsome
GO:0017110 = Molecular function: nucleoside-diphosphatase activity
GO:0017111 = Molecular function: nucleoside-triphosphatase activity
GO:0006486 = Biological process: protein amino acid glycosylation

Sequence:
>Contig4219
TTGGCATACATACAGCACTTTTTTCACTAAGGGGAACCATCGTCGTCCGT
CCGTCCGTTTGGGTTTGCTTCTGGTAAACTTTTTCATTCTTTTTCAGGAT
CGGATAGGAGGAGTTTCTGAAATTTTCTTGTTTAGCCGCCCGTTATGCCT
GAGAAATACGGAGTGATACTTGACGCCGGCTCGAGCGGGACTCGTATTCA
TATCTACAGCTGGGAGGATCCTGTAGAGACACGGAGGAAGGGGAGGAAGG
ATGAGCTGCGGAGGTTGCCTAGGATAAACACAAACAAAAAATGGGCCAAG
AAGATCAATCCTGGTATTTCGACGTTCGGCGAGCATCCGGAACGGGTTGG
GGAGGATCATTTGAATGGTTTGTTCGAACATGCGCTTAGCCAAATACCAA
AGGATGCCATCGCCCATACGCCATTATTCTTGCTCGCTACGGCTGGAATG
AGGTTGTTGCCAGATTTAGAGCGGAAAACATTGCTCGACGAGATTTGCAC
ATATGCTCGTCGGACGACACAGTTTCTCCTCCCCGATTGCGGCCTTCACA
TCCAGGTTATTGCGGGCGAGACGGAAGGGTTGTATGGCTGGATTTCGGCA
AACTACCTGTTGGGTGGTTTCGATGACCCGGAAACGCACGCACACGGGAA
GGGACATCACACATACGGATTTCTGGATATGGGAGGGGCTAGCGCGCAGA
TTGCTTTCGCACCGAATGCGACGGAAGCGGAGAAACACGCCGATGATCTG
GTATTGCTGAAAATGAGGAATTTGAATGGCGATCCGATGGATTATAAGGT
GTTTGTGACCACTTGGCTTGGGTTCGGAGTGAACCAGGCAAGGGGTAGGT
ATATCGATACTTTGGTTGAGGCAAGCTCCG

Sequences in the Contig:

SY0AAA48YJ02FM1 SY0AAB47YO10FM1 SY0AAC27YM16FM1
SY0AAD23YJ16FM1