Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4218
Length(NT) : 911
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4218
TTGGGCCAAATCAGTCTTTCCTTTATTATTTGTTACCTATTTTCTTCCTG
ATAATATTTCTCCGGCTAATTTCCCAAAGCCAAAGAAATCTATTATGATA
TTGACATGCTAGAAGTGAAAGGAAAAACGATGAAGAGAAAAGAGAAAGAT
GTGTTCCACTGGCGGAGGCATTGGCGGGTGTCGCTGCCCTTGCCGTCGGG
GATGGTTGCCACCGATATGTCCCAAGGTGGCAATGTGGGCGCCGGGGGTG
CAGGTGAGGGTGGTGGGTGGGAAATAAAGAACGCAAGCGGTAGGAAGCAG
GAAGTTTGGTGATCTTGTGGTGTTCGGGAGAGGTGGATCGTAGTTTATGT
ATTGGGGGTCCACGGGCCCCTCCTGGTGAGCTATGACTGCGCTCTGGATG
GGCAACCGGCTATACCTTATTCCGCTAACCTCCGGTGGACAGTACCCTTC
CCTGACAGGGTTCCCGACGCTTTGCCCAATTGGCAATGGGTTGTTTCAAC
CCGTCATTTAGGATATTCAATACTGTACGATATTTGCACCTTTGTCTAGC
CATTCAATTCGAGTCAACAGTGTCCAAATCGCAGCCGTAAGCCTTGTTGA
AAACGGGTCGCTTTAACAAAACCGTGCGGCATAGCTTGATCCGACCCTCC
GCCACCCTCGTACCCGGACAGTTTCCTACGTTATCAGCCCTCCAATATTG
AGGGTCAGGATGGGTATCTCGGGCTCTAGGAGGGATGGATAACTAAGGCA
GGGTTTCTGCTCGCTTGTTGCCAACCGCAACATGGTTTGGCACATGATGG
ACAGAGTTGTGCGGAAGAGATTGGCTATAATTAAACGAGTCAATACTATT
ATGACAAATACCAGAAATTTCTGTTTTTTGTCGGCAAGAATGCTCTTGAG
AATTTTGGAAG

Sequences in the Contig:

SY0AAC1YN08FM1 SY0AAC27YM14FM1 SY0AAC7YB20FM1
SY0AAD33YG20FM1 SY0AAD62YF08FM1