Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4215
Length(NT) : 1786
Best Gene Model Blast : Link to GSTUMT00004213001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein An18g01480
Accession: ref|XP_001398608.1| Score: 991 E_value: 1e-105
KEGG Definition: hypothetical protein
Accession: ang:An18g01480 Score: 991 E_value: 1e-105
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0156 Score: 746 E_value: 2e-79
PFAM Definition: p450, Cytochrome P450. Cytochrome P450s are haem-thiolate proteins involved in the oxidative degradation of various compounds. They are particularly well known for their role in the degradation of environmental toxins and mutagens. They can be divided into 4 classes, according to the method by which electrons from NAD(P)H are delivered to the catalytic site. Sequence conservation is relatively low within the family - there are only 3 absolutely conserved residues - but their general topography and structural fold are highly conserved. The conserved core is composed of a coil termed the meander, a four-helix bundle, helices J and K, and two sets of beta-sheets. These constitute the haem-binding loop (with an absolutely conserved cysteine that serves as the 5th ligand for the haem iron), the proton-transfer groove and the absolutely conserved EXXR motif in helix K. While prokaryotic P450s are soluble proteins, most eukaryotic P450s are associated with microsomal membranes. their general enzymatic function is to catalyse regiospecific and stereospecific oxidation of non-activated hydrocarbons at physiological temperatures..
Pfam Number: pfam00067 Score: 659 E_value: 2e-69
Swissprot: Q29510|CP2CU_RABIT
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0050381 = Molecular function: unspecific monooxygenase activity

Sequence:
>Contig4215
TTGGGATTCCGGTTTAATGGAGGCTTGCTATTCCGGTTTAACGGAGGCTT
GCTATTTCGGTTCCAGGCCCGTGCCACCTTGCCGTCCCTGGGGATTTTGC
TCCCTCGTCAACTTTGCCTTCTACCCCTTCGACAAAATGTGCATTGCAGG
AGCCGAGGATCCAGGAGGCCGCACCCCCCGGCCCATCACTATAAGGCCTC
TGGCACTCTTCACATCCTTCCTTGCTGTGATGATAGCCGCCTATCTTTTC
AAGCAGAAACGGCGACAACCTCCATTACCCCCGGGCCCCCGCGGAGTCCC
CATCTTCGGCAACCTCTTCCAAATTGCACCCAAATACCAGTGGCGTCAAC
AGCAGGAATGGTCCCAAAAGTACGGCCCAATCTTCAAGCTACAATTGGGT
GTTCACATGGTCATTGTCCTCGGGACGTACCAGGCCGCGCGGGATTTGCT
GGATAAGCGGTGGAAGATATACTCCGATAGACCGGGTTTCGTGGTCTCCG
CTAAGTACATTTCAGGGGGATTCCGGACTCTCCTTATGCGCGGAGAGATG
TGGAACGCCCACCGCCGGCTCCAAGCAACAGTGTTATCCCCGCGCATGTC
CCAAAAGTACAAACCGGTGCAAGACCTCGAAAGCAAGCACCTCATCCACG
CCCTCCTAAAAAAGCCAGACGACTTCGCCCGGCAATTCCACCGCTACTCC
GCCTCACTAGTTCACTCCCTGGGATATGGCAAGCGCCTGGTCACTGGACG
CGAGGAGGAGGTCCAGACGGTCGACACCATCATGCGGAACTTCACTGAGG
CTGGTCGTGTGGGGAAATGGTGGGTGGACATGTTCCCCATTCTCGAACTC
ATCCCAAAGTACTTTGCCGAGTGGAAGAGAATCTCCGCCAAGATCTTTGA
GTACGAGTCCAACTTTCACATTAAGAATCTAAACGAGGCCCTGGAGCGGA
AGGGGTGGAATTGGGCGAAGCTGTATAAGAATTCGTCATTTTCGCAAGGG
ATGTCGGACTTAGAGGTTGGATATGACCTTGGAACTCTAAACGAAGCCGC
CAGCGATACAACCACCATCGCTCTAGAAGTCTTCATGCTAGCGATGTTAA
AATTCCCGCACGTCGCCCGTCGCGCACAGGAAGAACTTGATCGGGTAGTC
GGTGAATCTCGATCGCCAACCTGGCAGGACAAGGACTCCCTCCCGTACAT
TGAAAAGGTCATCCAAGAGACACTGCGATGGCGCCCGGTCGCTATAAACG
CATTCTACCATGCGGTAACTGAGGATGACGAGTACCTAGGCTACCGCATA
CCAAAGGGTTCCTGGGTTGTGGCGAATTCCTGGGGGATACATATGGACCC
GGAGCTGTACCCGAACCCGAGCGACTTCAATCCCGACCGCTACGATGATG
AGAAGCTCGGACATGTGGCTTTCGGCTTTGGGCTTAGGGCTTGCACTGGG
AAGCACATTGCTAAGAATTCGTTGTACATTAATATCTCAAGGATATTGTG
GGCGTTCGATATTGGGCCGAAGATGAGGGCTGATGGGACGGAGGTCCTGG
TTGATGAGATGGCGTTCACGACTGGGTTTTTGTCCCGGCCGTTGCCATTT
GAGTGCTCGATTAGGCCGAGGGATCAAGGCCGTGTGGGGGTTATTGAGAC
GGAGTGGGCCGAAGCGGATAAGTCCCTTCTTTCAATCATGGCCGGGGGGA
AGTTTATTTAGGCGGTTTCTTCCCCTATCGATCTTGGCTACGTTTTCTAA
CTTCACCTTTCTCCGCCTCTCTTATTATTACCATAA

Sequences in the Contig:

SY0AAA39YG19FM1 SY0AAB38YC20FM1 SY0AAC13YB14FM1
SY0AAC27YK23FM1 SY0AAC27YK23RM1 SY0AAC33YE01FM1
SY0AAC56YM20FM1 SY0AAD30YO24FM1 SY0AAD48YD20FM1