Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4214
Length(NT) : 976
Best Gene Model Blast : Link to GSTUMT00003358001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001212445.1| Score: 428 E_value: 3e-40
KEGG Definition: translation initiation factor 2B, epsilon subunit (eIF-2Bepsilon/GCD6); K03240 translation initiation factor eIF-2B epsilon subunit
Accession: aor:AO090003000364 Score: 427 E_value: 2e-40
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1461 Score: 455 E_value: 4e-46
PFAM Definition: No Hit Found
Swissprot: P32501|EI2BE_YEAST
Gene Ontology:
GO:0005851 = Cellular component: eukaryotic translation initiation factor 2B complex
GO:0032045 = Cellular component: guanyl-nucleotide exchange factor complex
GO:0005085 = Molecular function: guanyl-nucleotide exchange factor activity
GO:0003743 = Molecular function: translation initiation factor activity
GO:0006446 = Biological process: regulation of translational initiation

Sequence:
>Contig4214
TTGGGAAGCGTTGTGGGAACCAGCACCATTGGCAGAAATTGTGAAATTGG
GTCAGGCGTGGTTGTTGATGGGTCTTACGTCTGGGATGGTGTGGCCATCG
GGGACGGATGTAGGATATATAGCTCAATCATCGCTAATGGAGTGAAGCTG
GGAAAAGACTGCATTGTTGAGAGAGGGGCTTTAATCTCCTATAACGTACA
TATCCCGGATGGCACTACCGTTAAAGCCGGAAGCAGGATCAGTACCTACA
AGAGAAAATCTGATATAGATTCTGATTCTGGTGATGAAGGGGACGATTTG
TTAGGCGGGCACGAATATGAGGAGGAGGAGTCTGAGGAGGAGGAGGAGGT
TATAATATCTGGGATGGATAGCTTGGGCTTCCAGGATGAAGATCTTGTCG
ATGGCTCAGAATCCTCGATATCCACCATTTCTGACGACGATGAGGATTCC
GATGGTGAGCTTACCCCTGGAGACAAGAAGCTTAGGAAGCGCTCAGATTC
AGTAACAACAGCAACATCGGAGGATAACGCTGAGGCGGATGCATGGCATA
AGGAAGCAGCTGTATCTCTGCTCACAGCCATGCAAGGAGACCACCCTGTT
GAAGTGGCTTCGTTGGAACTCAATGGTCTCAGGATGACATCGAACGCATC
TTGGCACCAGGTCCGCAGAGCCGCAGTCTCTGCTCTACATACCCGTATAG
AAGAGGTCGTCGCCACCCGGTCGAAGAGCCTGTCGGAGGTTACCAATGAG
GTCTTTACCCGCTGGGAGCTCCTCGTAAAGCGTATGATCTTTGACCAGGA
AGATCAATCGGATTTCCTATTACTAGTGCAAAAGGACTGCATTGAGAGGA
AGAATGGGGGTAGCCTTCTCCTGAATGTTGCACAAAGGGCCTTTGAGCTG
GATATAGTAGAAGAGGAAGCTATCAATACCTGGTGGGAGGACGAGAGGAG
CTCCACCGACGCAGGCGGAATGAGTA

Sequences in the Contig:

SY0AAB12YP09FM1 SY0AAC26YD21FM1 SY0AAC27YK16FM1