Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4213
Length(NT) : 1292
Best Gene Model Blast : Link to GSTUMT00010320001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein BC1G_01545
Accession: ref|XP_001559986.1| Score: 534 E_value: 2e-52
KEGG Definition: hypothetical protein
Accession: fgr:FG01454.1 Score: 425 E_value: 4e-40
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, Intracellular trafficking, secretion, and vesicular transport, Signal transduction mechanisms].
Kog Number: KOG0595 Score: 137 E_value: 4e-09
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 148 E_value: 3e-10

Sequence:
>Contig4213
TTGGAGCCCTCGCTCCCCCGTTTCCCTCTTTTTTGGGGGGTGAGATACTT
GGCCTGGAAACAGTGTATGATGCGATAGCCTGATTTGGGCCTTCCGGTTA
AGTCATTGGCTCGACCCCCCCTTCCCCAGAAAGAATTGCATTTCTCAATC
GTCTTCACTATTGAGCAGAAATTCGAATCTCACAATACATACAGGCTCAC
CATGGCGACCCTAACCAGGGCCGATCCTCATCGCGCCGACCTCTTCCACA
GCATGTATGGTTATAGCAGTTCCAGCGTTGCGCTTCCACCACCCGTGCTG
CTGACGAGTACTTGGTGGGACGAACAAAAAATCCGGGAAACCGCAACCCC
GTGGTTCGTCCGTCAAGCACTGCGCTCCTCCTCTTCGAAAAAGCGCCTAG
ACGAGCAATTGCAATTCGGCGAGGGGTTAACAGAGAGTACGTACCTGGAT
TGGATACTCGAGCACACAAGGAAATTCTTCCTGATCTTGGTGGAGCTGAA
TTGCGCCGAGATGATTTTCGAGATCATAGATGGGTCATGGGATGATGAGG
ACTTGCCACTCAGCTTACAGACGGTGGAGAGGTTGGGGCTAGGTAGCGCA
GGGGTGGAAAAGAAGTTTGCTAAGAAACAATATGCTTATTTGGTGAGGGA
GTTGGTGCCCGGTGAAACGGTGGAGTATTCGGACGAAGAGGTGGTTCCTC
TAGAGGTCATTTCCAGGAGGGTGCCGACTACATCTAGTGGGGCCACAAAG
GGCGGGCTAGTTGAGAAGGTTTATTTTCCGAGGCAGAGGGAGGTGTATTA
CTCTCGGCGACGGGTACTGCTAAGCCAGGAGGGGGATGAAGACAGCGGAG
TAGGAGGGAATAAAATGTCGCCTGCGTCATTCTTTGAGGAAATCTCCCGT
CTTGGATCAATCGATCATCCACACATAGTTTCTATATTCGCCTCTTACAC
GCAAGGTGACTACGGGTTTCTAGTCCTTTCGCCATGCATCGACTTAACGT
TAAAGTCGTTCCTGCATTCCACACCCCCAGCTTGGAAATCTCAGCCAAAA
GACAAGCGCCGGCGGATAATCTTCAATTGGCTACACTGTTTGGCAGACGC
GCTCGCGCACTTGCACGAGAAGGGTATTTCCCACGGCGACATCAAGCCTT
CATCAATCATAATCGAAGCAACCACCTACAAAATCTTCTTCGCAGACACC
GGAGATTTGAAACGCCTCGACTCCTCACCGACAAGCGCCGTGGGTCCATC
ATCCTTTCTCCCCCGGAAGTTCAACACATCACCCGTATCGGC

Sequences in the Contig:

SY0AAC27YK13FM1 SY0AAC35YD14FM1 SY0AAC45YE22FM1
SY0AAC6YI15FM1 SY0AAD4YI23FM1