Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4212
Length(NT) : 1223
Best Gene Model Blast : Link to GSTUMT00006805001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein BC1G_14992
Accession: ref|XP_001546495.1| Score: 821 E_value: 1e-85
KEGG Definition: hypothetical protein
Accession: ang:An11g01790 Score: 799 E_value: 2e-83
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0075 Score: 655 E_value: 4e-69
PFAM Definition: Arf, ADP-ribosylation factor family. Pfam combines a number of different Prosite families together.
Pfam Number: pfam00025 Score: 370 E_value: 4e-36
Swissprot: Q96BM9|ARL8A_HUMAN
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0030496 = Cellular component: midbody
GO:0051233 = Cellular component: spindle midzone
GO:0043014 = Molecular function: alpha-tubulin binding
GO:0048487 = Molecular function: beta-tubulin binding
GO:0005525 = Molecular function: GTP binding
GO:0003924 = Molecular function: GTPase activity
GO:0007059 = Biological process: chromosome segregation

Sequence:
>Contig4212
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCCCCCTCCCTCATTCCCT
CCCACTCCACACGTTTCGTGGAGCCTTTGCCAAACATTGCCTTATTTTTA
TCTTTTCCCTTTACCCTTCTTCAACAAACCTTCTTAACTCTAGCTAGTCG
TTATTCTCTCCGTCCCTCTCTCCTCCCCTCCTCCTTCTCCTCCTTCTCCT
ACACCTTCCTCCTCTTCCCTTCCTTTCCGTCCGTCCGTATACTTTGGTGT
CCCGACACCCATCAGCATCCACCATGTCGGGCTTTTTCCGTCGCATCTAT
GATTGGCTACTCCGCATGTTCTGGGCTACGGAGATGGACGTAACCATGAT
CGGGTTACAGAATGCCGGGAAGACGTCCTTGTTAAGAGTTTTGGCTGGCG
GAGAATTTACATACGATTCTATTCCTACAGTAGGATTTAATATGAAGCGG
GTACAGAAGGGCCATGTTACCTTGAAATGCTGGGATCTCGGCGGCCAGCC
GCGATTTCGCTCCATGTGGGAGCGGTATTGCCGGGGTGTGAGCGCTATCG
TCTTCATCGTCGATTCAGCAGATGACTCTTCTATCCCCATAGCAAAAGAC
GAGCTCCATTCCCTTCTTCATAAACCAATGCTGAACGGAATCCCGTTGCT
GGTACTGGGCAACAAGTCTGATCTCCCGGACAAGATCGGTGTGGACGAGC
TGATCGAGGTGATGGATTTGAAAGACATCACAAATCGGGAGGTTAGCTGC
TACTCGATATCGGCGAAAGAGGAAACAAACCTGGACGCAGTGCTTCAGTG
GTTGATTGGCCGGGCGAAGAAATGAGGGCGAATTTTTCAATATTTTTTTT
ATTCTCTTTCGCTTCTCTCTTTCCCGATTCTTATGCGGGGCTTGCGGGGG
AATATATATAGTTTGGGCGGACGGGATGGATTGATATCTGGGAGTATGAA
TACCTTGAGCGTGGATGAGGCGGGGAGCGCCGATGTGACGAACTTACGAA
GTGTGATGGTGATCTGTAGGCATTTGTTAATACACCTTTTCTTTGCTATT
TTACTGTTTCTTTTTATACTTTTTATCAAAGCTTTATTAAAGCTTTTTTT
CCCTCTTTCGTTGAAACGCTTTTTAGTCACTTTTGGTCTACTTTTGGGAG
CTCTCTTTGAGAGCAGCAGTATTAGCGTACCTAGTTGCCTACCTACTTAC
TACCCATCTACTATCTATCTACC

Sequences in the Contig:

SY0AAA15YD03FM1 SY0AAA20YI19RM1 SY0AAB25YJ11FM1
SY0AAB38YO04FM1 SY0AAC27YK10FM1 SY0AAC27YK10RM1
SY0AAD34YH02FM1 SY0AAD45YF09FM1