Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4210
Length(NT) : 701
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4210
TTGGAACACTTCAACGCGAAAGCCTATGAGAGCCCCAAATATTCTCAGCG
CCCCCGCTTCCAACCAGGGTTGCTCATCTCGATACCTCGACTGCCAACAA
GCGCCGGCAGGGACAAATTTCATCGGTTTCGAGGCCTGATTCCTTGAAAA
CACGGCTTGAGATCAGCTTACATAACAGCCTATTCACTATGCCATCAACG
CCCCGACAGAAAAACTCGGGCAAAAATGCTAGCGGTAAGAAGCTCGTCCA
GACCAAGTTAAATTTTTACGTTAAAGGCCCTGCCCCACCGTCGTCATCGT
TATCCTCGGGCCCACAAAATCGGCGCGCAGACTCCACGCCCGGGACATTC
GGGAGGAGGTACATCAGAGAGGATTCGACGGAGCACAAGGAATTTGGAAC
TTCGGATCTAGAATCTCAGTCTCAAGGATCTGGCTCTCAAGAAATGGATA
TTGAATCAGAATCCCAATCTGGAGAATTTCATTCGCAGCAATCGCTCGGG
AAATTGAAGCCGCAAAATGCGAGGTATAATCAGAAGAGGGTGGAGGTTGC
GCAGGAGACGACGTGGACTTCATACCTAGTATACTTGCTAAATTTCCTGC
GGCGCAGCAAAAGTCGTCATTATATTTGGGAGGGGAACTTTCTCTTGCGG
GAATAGTTTGTTCGGGGTTTATGTTACCGGACCTCGACCCGGAAGCTGGA
A

Sequences in the Contig:

SY0AAA12YO01FM1 SY0AAB23YF23FM1 SY0AAC27YJ05FM1
SY0AAD32YC12FM1 SY0AAD43YP01FM1