Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig421
Length(NT) : 929
Best Gene Model Blast : Link to GSTUMT00007209001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE62854.1| Score: 436 E_value: 3e-41
KEGG Definition: cell division control protein/predicted DNA repair exonuclease
Accession: aor:AO090120000250 Score: 436 E_value: 1e-41
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG3662 Score: 217 E_value: 2e-18
PFAM Definition: No Hit Found
Swissprot: P40533|YID9_YEAST
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0005515 = Molecular function: protein binding
GO:0006888 = Biological process: ER to Golgi vesicle-mediated transport
GO:0042493 = Biological process: response to drug

Sequence:
>Contig421
TTGGTCTACATGCCCGAAACCCGGCATCTCCTACAAAAATGACGATAAAA
AACCTCCTAATAATAATCCACCTAGACCTACTCCTCCCACTAGCCGTGTT
CCTAAACCTGTACCTATACTTCTACCCCGTCTTCCACTTCTGCGCCTTCA
CGCCTCAACCGGATGGGGGTGCAGCACCCTTCCGCCTGCTAAAGTACAGA
GCTGGCCAGCCGACAGAAGCAACAGCACCGACAACAGGCACATCCTCCTT
ATGGGACTACGTGCACCCTACCGACATCGGCCTCACCATCCGCGGACTGG
GCAAGGTGCTGGACCTCTGGGGAAACGATCTCTACCTCCGCCATATATTC
CGCAGCACCAGGCAGATGCTAGCGCCTACGCACACGATAGTATTGGGTGA
TCTGCTGGGCTCGCAGTGGATCAGTGATGAGGAGTTCAAGATCCGCGGGG
AGAGGTTCTGGAGGATCTTTGGTGGGGAGGAAGGGAAGGTTACGAGTGAG
GATGTGCAGAGGTACGCGGGGGATATCGCCGCGGATGAGGAGGCCAGGGC
GGTTTGGCGGAAGAAGGTGATTATAGTTCCTGGGAATCACGATATCGGAT
ACGCCGGGGATATGGATTGGAATCGGATCACGCGTTTCGAGGAGATGTTT
GGGGTTGCCAATTATATTGTTAAGTTTATGCCCAACACGTCCAGTTCTGT
CAGTGCTAGCAATATCGCCGGTGAAGCAGCTCAGGGAGAGGAATCACAGA
AAATCCCCCCAACCCTCCGCCTAGTAATCCTAAACTCCCTCCCGCTAGAC
TCCCCAATCTTCGACCCCACGATACAAGACGCCTCTTATGCACTCATCGA
CCAATCGCTAGAGTCCAAATCCCCCTCTCTCCGCCAGTCCTCCCTCCTCC
TCACCCACCTCCCCCTGCACAAGCCCGCA

Sequences in the Contig:

SY0AAA23YK04FM1 SY0AAC2YA16FM1