Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4209
Length(NT) : 2013
Best Gene Model Blast : Link to GSTUMT00006698001 E-value : 2e-42
Numbers of ESTs : 9

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4209
TTGGACTGTACCCGCCGTAGGGCGCTCGAGCATAGTCTGCGGTTTGTGAG
GCCCAGCACTGCTTTTACCATCGGTATACGGGTCAACCTACACGCTCCAG
CGGCCTGATTATTCCCTTCTCTCTTCTTTTCACTTCTGTTGCGTTCTATT
GTGCCGGCAGGATTGGTAACATAACCCGGTTGAACGGCGATTACCCGCGT
CTCGGGGCTGGTGGCGTATCAGCGGCGACCGCTCCTGGGAGTCCTGAAAT
ATTAGAAAAGTCATCGCGATATCATCTGGTACGATGATTCACTTTCCATC
AAGTCAAGGTATCCCCAGAGAATCATGCGCACCTCGTGTACGCGCTGTAG
AGTGCGTACATCAGCATGCTATGCCCTCCATGGAGTTTTTTTTCCCCCGG
GAATCATCATACCCAAATTACTATCACTCAGGCTTACCCGGTACGCCCTC
CACACCCCAGCGAACAGTCGTCCATCGCCAAGCCGCGGGTGATTTTCCAT
AGCCAACACTGTTCAACACGTTACTGTGCTCACTCATTTGCCAATTCCTC
CGCCAGCCGATAATTTGCTGCAGCCCTCACCAAATATTCGGCTCACGGAG
GTATAATTTTCCCGCCAAAGACGCGTGAGTGTGGTGCTGGTGCGCCTCAC
ACCACAGTCAGTAATCAACCTACCAACCTCGGAGACACCCCACATAATTG
TCCGAGATATCGTCAGTTATTTGAGTCTCGTATAGCCAAACACAACAGCA
GTCAATCTCCTCGCGAAAATTATTCACTGAGCCGATACTGTACACGTACT
CTACGTACAGTACAGCCACATCTGCAGAACTCTCAACCCTCCCCGTACCT
ATTCTCTCGAAATTCACTATCTCCGGCAGTCCTGCAATCTCCGGACTCTG
AGTCAAGAGCTCCTTGGAAGGACTAGTGTTTCCCGACACGGTATGCGATC
GACCCACTGGACGTGTTTGATCTCGTTAATCGTTAATTGGTATGCAATCC
TGTCAACCTGTCAAACCAAACCTATCGTGGGCTGATTAGATAATTTCTGC
TGATAATCTGATAGTGGATTTCAAGAGATTATGATCCTAGACCTCAAGAA
CCGTATCCGTTAACAAGAGGGCAGGAAGAGCCCTTTGGATAACTATTTTG
AGATATGCCTTCAGGGGTATAATTGTAAACTTTTACCGCAATTTGTTTTT
CTGAATAATGAGAAAGAGAGGGTTAGCTGAGCGTTTCCAAGGGCTGAGGG
TACAGTACCCGGATAGTAAACGCAGGGCCGAGGAGGATGTTTAGCTCGGC
ACCTATCGTTCCAATCAGTTTATGTAATTTGACACTGTTTAGAAATACCT
ACTATTAAGTGCTTCGATATCCATGGGGATTGCTGGAAACATGTTTTGCG
AAGCTGTCTTGTTCGCTAAACAACATGCGATTCTAATGTAGGAAACAAAC
TTACCAGCGCAAACTGTCTCGGCAAAGCCAGGCAAATTGCTCCTCCCCTT
CTTTCGATTCTGCTTTAACTACTTTTGCTCTGTCTAGTACCACTCTATGC
GTGCAGGACATGCAGAATCTACCGGTTCTGCAGCATTCGCTGTTGGAAGG
TTTGGCATCAATGCTAGACTAAATTACCTTCTTTCGCGACGTGAGCCGTG
CCGGGGTAGGGATTTGTTTACTGGCACAGATCTCATTAGGGCTGCTGGTG
AACAATCATACTTACCAATGGCAGTGGACGGGCTCCCCCGGCAAGCTCCC
TCGACTTCATTCCAGGACGGCCGTGGGGCCTCACATTCCAAGGCATTTCT
ATCAATCCACGGTGGAGCCCTTCGTCCTCCCCGTCCTACAACCAAAAGAA
AACCCCGGGCAGAACCCTCTCCGGGATTGGACGGACTGAACCGCTGCGAA
CATTGTTGGTGCCATTCCGCCGTGTGATGCTGTATCTATAGCCGGGTATG
TTTGGTGGAGGTGGTGGCTTAGAGGCGTGTTGGAGATCGTATCGCCTCTG
GTGAGTGGCCCAA

Sequences in the Contig:

SY0AAB6YO07FM1 SY0AAC21YD16FM1 SY0AAC27YI23FM1
SY0AAC35YA24FM1 SY0AAC35YK24FM1 SY0AAC7YA22FM1
SY0AAD22YA04FM1 SY0AAD28YI20FM1 SY0AAD36YL11FM1