Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4208
Length(NT) : 1005
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 342 E_value: 3e-30
KEGG Definition: ankyrin repeat
Accession: aor:AO090206000090 Score: 274 E_value: 1e-22
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 187 E_value: 6e-15
PFAM Definition: No Hit Found
Swissprot: Q9Y283|INVS_HUMAN
Gene Ontology:
GO:0005819 = Cellular component: spindle

Sequence:
>Contig4208
TTGGTGAGGAGGTGGCAAAGGTGCTTTTGGAATGAGGGGATGTCAATCAC
GACCAGGCAGACACCGAATATGGCCGAACGCCACTTTTGTGGGCCGCTAT
ATACGGGCATGGGGGGGTAGTAAATATGCTTTTGGAAAGAGGGGATGTCA
ACCCCAACCAGGAAGACTTCGTATATAGCCGGACACCACTCTGATGGGCC
GCTATCTGCGGGAATGAGGGGGTAGTGGGGATGTTTTTGGAGAGAGGGGG
TGTCAATCCCAACCAGGCAGACATCGGACATGGCCGGACATCACTCCTAT
GGGTCGCTGAGGATGGGTATGAGGGGGTAGTGAAGCTGTTTTTAGAGCGA
GGGGATGTCAATCCCAACCAGGCGGATACCAAATATGGCTGGACGCCACT
CTCGTGGGCCACTAGGAACAGGCATGAGGGTGTAGTAAAGGGGCTTTTGG
AACCGAAAGGTGTCCGCGCCACCACTCCAGAGAGTGTGAACCAAGCACCA
CTGTCCAGGGCTCTCCCTCTGCTCGGGGTAAAGGACATTATCGAGTCGTA
AAGATTCTACTCGAACGGGACGGTGACAATTCTGACAGCAGATCGCATTG
GCTGGGCATCATAGCTAACAATCACACCTATCGGCAGACCCTAATGGGCG
GGAGCTAGTATCGGACCTCAGAGACTCTCTTCCTAGTTCGCAGATAGCGA
CCTCCCCTCAACTGAGCAGTCCAGGCTGCCTCAACCCCCCAAGATTATAG
CATCTTTTCAGGAAAACCGACGCCCATTCTAGCAACATTCGATAAATTCT
CTCTTGCGGTTGGCCGGCAGACCGGTGTCTTACTATTGCCTCTTTGGTTT
TGTTTTTTGGCTTTTCTCGTTTATATTTTCTATCTTCGTTACTTGAAACA
TTCCCGCTCTAGAAAGGACTACTAAGTGGTGATATTAATAATAGGCTTTG
ATGAGGGGTGTTTTTTTTCCGATTTTGGCTCGCTATTTGTTATCCATCTA
CCTTT

Sequences in the Contig:

SY0AAC27YI13FM1 SY0AAD49YF12FM1