Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4207
Length(NT) : 780
Best Gene Model Blast : Link to GSTUMT00003968001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG01703.1
Accession: ref|XP_381879.1| Score: 857 E_value: 3e-90
KEGG Definition: hypothetical protein
Accession: fgr:FG01703.1 Score: 857 E_value: 2e-90
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2220 Score: 377 E_value: 4e-37
PFAM Definition: BRO1, BRO1-like domain. This domain is found in a number proteins including Rhophilin and BRO1. It is known to have a role in endosomal targeting. ESCRT-III subunit Snf7 binds to a conserved hydrophobic patch in the BRO1 domain that is required for protein complex formation and for the protein-sorting function of BRO1..
Pfam Number: pfam03097 Score: 682 E_value: 2e-72
Swissprot: Q7S532|PALA_NEUCR

Sequence:
>Contig4207
TTGGCGGCCCTCCATATACCCTTTGGTTTCCTTATCCTATAGAATCCCCA
CTATGACCTCTTCCAATATTCTTCATGTTCCGTTTCGAAAATCTGCCCCG
CTTCAACTATCTACTGCCATCAAGCAGTATATCTCCACTAAGTATGATCA
ACACCCGGACATGTTTACCACCGACTTGGCAGCCATAGACAAGCTCAGGA
GCGATGCTATCAACGTACAAGAAGCGCATGTGAGTGGAGTTATGAAGATC
TCGGTATATGCAGCGCAGTTGCAGTGGATTAGCGGGAAGTTTCCTATAGA
TATTGGGGCGGATTTTACGTGGTATCCGGCACTAGGGTATAATACACAAC
GTCCGGTCACCCAAAATAACCTACAATTCGAGCGTGCAAACGTCCTCTAT
AATCTCGGATCCCTTTACTCCCAGTTGGCGTCCTCCTCTCCACGGACAAC
AGCCCAAGGCCTCAAAACAGCTTGCAACTACTTTTGCGCAGCCGCCGGTG
TTTTCACGTATCTCAAGAAGGAGGTTCTCACAGAGCTCCGTAGCACTCCA
CCGGAAGACATGGATGCCGGCACTCTGGAGTCTTTGGAGATGCTGATGCT
TGCTCAAGCGCAGGAGTGCTTTTGGCTAAAAGCGGCCGTGGATGGACATA
AAGATAGTTTAGTTGCTAAGTTGGCGGCAATGGTCAGTGATTTTTACGAC
CTGGCTGGCGAATTTGGAATGAAGAGCGACTCGATCTCTTCGGAGTGGAT
GCACCACTTGTCAGCCAAACACCACCATTT

Sequences in the Contig:

SY0AAC27YI10FM1 SY0AAC46YH01FM1