Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4205
Length(NT) : 395
Best Gene Model Blast : Link to GSTUMT00009772001 E-value : 1e-123
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein MGG_00168
Accession: ref|XP_369076.2| Score: 333 E_value: 6e-30
KEGG Definition: hypothetical protein [EC:1.3.5.1]; K00234 succinate dehydrogenase (ubiquinone) flavoprotein subunit precursor
Accession: mgr:MGG_00168 Score: 333 E_value: 3e-30
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG2403 Score: 288 E_value: 3e-27
PFAM Definition: Succ_DH_flav_C, Fumarate reductase/succinate dehydrogenase flavoprotein C-terminal domain. This family contains fumarate reductases, succinate dehydrogenases and L-aspartate oxidases..
Pfam Number: pfam02910 Score: 273 E_value: 2e-25
Swissprot: Q00711|DHSA_YEAST
Gene Ontology:
GO:0005749 = Cellular component: mitochondrial respiratory chain complex II
GO:0005515 = Molecular function: protein binding
GO:0008177 = Molecular function: succinate dehydrogenase (ubiquinone) activity
GO:0006121 = Biological process: mitochondrial electron transport, succinate to ubiquinone
GO:0006099 = Biological process: tricarboxylic acid cycle

Sequence:
>Contig4205
CGATTAATCGTATTTTTATTTAGTCATCTACAATATAATCCCAACCAAAA
AGTCAAAAAAAGAATGAAATAAAATAAAATAAAAAACTACCGTTGATTGA
ACCATCTACTGATAACACCGCGACCCTTCTCTCCCTAGCTGCGTTTTTTG
ATTTGAATTCGAATTTGGTTTGGTTTAATATACACGCTTGAAAGGCGGGA
CCGCCGCACACTCCTTCTCATCTAGGGTATTTCCAACGACTGCACGGTAT
TTCAAGTCGACCTTACCGTGTTGCTCCTTCTGCCACGACAGTGTATGCTT
CATCCAGTTCTCATCGTCACGTTCAGGGTAATCTTCTCTTGCGTGCGCTC
CACGAGACTCCTTTCTGGCCGCGGCCGCGTGTGCGGTTTGAGTAG

Sequences in the Contig:

SY0AAC27YH19RM1 SY0AAC28YF24RM1