Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4204
Length(NT) : 441
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4204
GTATCAAAGCAAAATCCCTCCAAATGTATTCTTTCCCATTCTCCCAAAAC
GAACTCAAATACAAGACAAGCTAACAAGATACCGACCTATGAAGCTACTT
AGCCTCTGCGCCCACACCCAAGAGTTGATTAGCAGCAGCAGAATAATTAT
ATAATGCAAGATGATAACTAGCATGAACACCTGCATCAACAAGAGGGAAA
GGGAAAAAAGAAAAAGAAAAACAGAGAGTGTGATAATAGGTGTGCTGACA
TAGGAAAGGACACAGATAACCCGACAGAGTAATAGCAAATAAGGAACCAA
ACCAGAAGTACAAGTACAAAAGTAAAGAGCAAAGGAACGCCGTGCCCACC
TACCCATGCATTTTCTCCCACTTCCGAGAAAAAGAAAAAGAAAGAGAAAC
AGACAGTTAAGGGAAATACCGATAGACCTATGCCATGCCAA

Sequences in the Contig:

SY0AAA19YL04RM1 SY0AAA2YP07FM1 SY0AAB50YM02FM1
SY0AAC27YH18FM1