Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4202
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00001814001 E-value : 2e-06
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4202
TTGGCAGAATCATCTTCACCAGCTACAACCCCTCCTTCCTTCCAATTTCT
CAAGCCCTCCCGAAGGACTTCTTTATCACCTCTGCTCGGTCCCGCGAAAA
CCTCTCCCAAGCTTCCCCAACAGCCCAGTTAACCAGATATTGTTAGCCAC
ATCGTATTTCGGGAATATGAGCGGGAATCATTTCGTTCCACCGCTTCAAT
CTACCATAAAAACTCAAATAATTGAATCTCACACTAAGACGTTGGTGTTG
CCATTCTGATTGCCTGGAAATGAACCATGTTGTAGCAGTTTACTTATCGC
ATGGCTCGAGGCATGCCATTCGGCAGATCAAAGATTAAATGTCTTAGTGT
GATGTTCAATTATTTGAGTTCCTACCATACCACAAAAACTGGAATAATTG
GCCCTCAGGCTAAGACGTTCTGAACTGCCTTTCTTGAATTAGAGGGTGCG
ATATAGTAAGAAAGCTGTCTTTCAGCACAAGTGACCTTAAAGGAAGAGAC
AACTTCAACGTCCTAGCGTGGGGTCCAATTATTTAGTTTTTTTGGAGATT
GAGGAAATTGTACCAACGAGGTACAGCCGCCTGGGATCATGCTAACGGTG
ATATCGTTTGCAAGCGGCAAAAACTTAC

Sequences in the Contig:

SY0AAA63YI23FM1 SY0AAB30YH09FM1 SY0AAC27YH07FM1
SY0AAC30YE15FM1