Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4201
Length(NT) : 1402
Best Gene Model Blast : Link to GSTUMT00006084001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: CLPTM1 domain protein
Accession: ref|XP_001270138.1| Score: 1058 E_value: 1e-113
KEGG Definition: hypothetical protein
Accession: ani:AN6601.2 Score: 1048 E_value: 1e-112
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2489 Score: 733 E_value: 4e-78
PFAM Definition: CLPTM1, Cleft lip and palate transmembrane protein 1 (CLPTM1). This family consists of several eukaryotic cleft lip and palate transmembrane protein 1 sequences. Cleft lip with or without cleft palate is a common birth defect that is genetically complex. The nonsyndromic forms have been studied genetically using linkage and candidate-gene association studies with only partial success in defining the loci responsible for orofacial clefting. CLPTM1 encodes a transmembrane protein and has strong homology to two Caenorhabditis elegans genes, suggesting that CLPTM1 may belong to a new gene family. This family also contains the human cisplatin resistance related protein CRR9p which is associated with CDDP-induced apoptosis..
Pfam Number: pfam05602 Score: 741 E_value: 5e-79
Swissprot: Q6DEL2|CLPT1_DANRE

Sequence:
>Contig4201
TTGGCAATCTTCTGGCCAACTTGAACCATACTTCAATATGCCCGCACCAA
ATTCCCAGATCGCCGGAGCCGGCGAGGAGGGCAGTCAGTCGGTCATCAAA
TCCGTCATTAATGGGGTTCTCATGTTTGTGGCCATTCAAACCGCCATGAA
GTTCATAATTCCTAAGGCTGGTACGCCCGCCACAACAACTCCATCCTCGT
TCGAGGAACGGACCTCTCCGGATGATCCATCGACATACATGTTTGTCCCC
GAGAAGGTTTTCCCCCTTTGGCCTGCGGAGGAGCCGGTAGATATTTCCAT
CTATGTATCTGAGTTGCTCGCCCTACCGCCCCTCTCCTCTGAGCAGATGG
CCTCTAGCCTTGTTTTCAACGAGAAGAACTTCCAGGCCGATGATTGGTCG
GAGCACCGTAGTGTGACTGTTGATATCCCACTCTCCCAACACGTACAGAA
CAATGGCACCCTGTTCGCACACATTTATGTTAGTCGTTCTGGGTCCGCTA
TGGATCCTACCGACCCCGATTATGACAGCTCCAAAGCCTTTAGAATCATC
TCGCTCTTGACTAAATATATGCCAAAGAAGAAGATTGTTAAGACCAAAAA
ACTAATCGGCGGTGACGATCAGGAGAGCGGGGATGAGGAAGTTGCTGTAC
CTGACAACTCCGGATCAATAGTCTCATACTTTCATCCTAACCTAACACTG
GATGTAGTCAATAATGCTGATATTATCAGCTTTAACACACTTCCGCCACC
ACTCCGCCAACATGTGGTACTCGAGGCGACTGGCGCTCGGGACTCAACCG
GAAAGAATGGATGGTATTATCCAATCGTGTTTGTGAACGAGTTCTGGCAG
TTGAAGGACCACATGATTGAGCTGAATAGCACGGTTAAATCTATCCCTAT
GCATATCAATCTTGCTCCAACTAGCTGGTGGAAATTCCAGATGTACTCCT
CTTTTGATGCATCCTTTAAACAAACGGTTTCCAACCCCGGAATTGGAGGT
TCAGCAAACACGGGGGCTGAATTGGAGGAACTCAAGCGTGTCCTTGTGGA
AACTAACATCTTCCTTCTCGGAACCACGTTTGTTGTATCCATATTGCATA
CCATCTTTGAGATGCTGGCTTTCAAGAATGATATATCTCACTGGCGTAAC
AAGAAGGACAACGTAGGTGTCAGCGTGAGAACCATCCTTGCAAATGTCTT
TATGCAAGCTGTTATCTTCCTTTACCTCCTCGATAACTCGGATGGAACTT
CCTGGATGATTTTGGCAGGTCAGGGATTCGGTATACTCCTCGAAGCATGG
AAAATCACACGCATGGTCAACGTCAAGATCCGACCTGTCAACAGTTTCAT
TCCTTATAGGGTGATTTTCGAAGATAAACACAAGTTATCAAATCTTGAGA
AG

Sequences in the Contig:

SY0AAA32YL03FM1 SY0AAA60YG07FM1 SY0AAB23YK08FM1
SY0AAC19YE01FM1 SY0AAC27YF17FM1 SY0AAC53YC23FM1
SY0AAC57YJ08FM1 SY0AAD18YA19FM1 SY0AAD9YI14FM1