Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4200
Length(NT) : 464
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4200
CTGGGGAATTGCTAATACCTACCACCTTGCTTCATTCAGATGATTGTATT
CAATCCACCATTCCTCAGGTTCTCGTTCCCTCCGTTGATCTCAGACTAAT
CCCGCCCTTGCTTTCCTCAATAGCGTTTCCTTGAACCCTTTTGTATCCCG
GACATGCCAGAACCGCACACCTGGTCCAGCCAGTGCATGACCTTCTTGTC
GTGAAGGGCTAGTCTCGCCAATGTGCGTTATTTGCTGGAGGCCCGTTATT
TATTCAATTTGTTTGCAAGCTCGATGCCGGCGTCGTTTTTCGCTCACCAT
ATTCTGCGCTTGGTCTAAAGGTTTGGCTGAGCGAGGGGTATGATAGCTGT
CTCAGGATGTAGGAATTTGTGGGGGATAACTGTTTGTTCTTTTTGTTACT
CTTGCACTGTACTCGCGTCTTCACAACCTTATTGCTCCGCAACTTTATAA
ACCCCAACAACCAG

Sequences in the Contig:

SY0AAB40YH24FM1 SY0AAB61YO02FM1 SY0AAC27YF16RM1