Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig420
Length(NT) : 850
Best Gene Model Blast : Link to GSTUMT00006856001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hexokinase
Accession: gb|AAG28789.1|AF309088_1 Score: 1166 E_value: 1e-126
KEGG Definition: hexokinase Kxk, putative [EC:2.7.1.1]; K00844 hexokinase
Accession: afm:AFUA_2G05910 Score: 780 E_value: 2e-81
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG1369 Score: 643 E_value: 6e-68
PFAM Definition: Hexokinase_1, Hexokinase. Hexokinase (EC:2.7.1.1) contains two structurally similar domains represented by this family and PFAM:PF03727. Some members of the family have two copies of each of these domains..
Pfam Number: pfam00349 Score: 669 E_value: 5e-71
Swissprot: P33284|HXK_KLULA

Sequence:
>Contig420
TTGGCCTTTCCCCCCATCCCATCAGCTATTCCTCCGCCGCCCAACAAAAC
TAAAGTAAAACACCACTCGTTACTTACGAGTGGCCTCCATTTCCAGGTTT
CTTCCCTGGGATTTGCCATAGCTTCTCTCATTCGCAAGGCTCCATCACCC
TGCGCAAAAAAAGATGTATCTCAGTGCATCTCGCAAGCCGCCTAGCCGCA
AAGGCTCCATGCACGATGTGCCGAACGATCTCATGAAGCACATCCATGAA
CTCGAGAAGATGTTCACCATTGATACGCCAAAGCTCCATGAGATTGTATC
CGTATTCCAAGAGGAACTGATCAAGGGGTTATCTGTGGCAGGCGGCACAA
TTCCCATGAACCCAACCTGGGTGATTGGATATCCCACTGGCGATGAGACG
GGCACCTACCTCGCTCTTGATATGGGCGGAACAAATCTTCGTGTTTGCGA
GGTTGAGCTTCCTGAAGAGAAGGGCCAGTATGAAATCTGTCAGTCCAAGT
ACCGCCTTCCAGAAGAGATCAAATCTGGCACTGGGGAACAGCTTTTTGAT
TACATTGCCGAGTGTGTCAAGCAATTCTTGGTCGCAAATCATGACGGCCA
AGATGTCAAGGATCTGAAGGAGCTACATCTTGGTTTTACCTTCTCATATC
CGTGCGAGCAGAATGCTATTGATCATGGTATCTTGCAACGTTGGACCAAA
GGTTTCGATATTGAAGGTGTTGAAGGCCATGACGTTGTTCCCATGTTCGA
AGCTGCTCTCGAGAGAAAGGGGGTCCCAATCAAAATTACTGCTTTGGTCA
ATGACACCACTGGAACTCTGATCGCTTCTGCGTATACCGACAATACTACC

Sequences in the Contig:

SY0AAA10YE08FM1 SY0AAA23YJ22FM1 SY0AAA3YA21FM1
SY0AAA52YO19FM1 SY0AAB13YH07FM1 SY0AAB60YC02FM1
SY0AAD27YO05FM1