Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig42
Length(NT) : 1092
Best Gene Model Blast : Link to GSTUMT00000526001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig42
TTGGCGCGTGTTAGGCCACCTGTCCAGCCCATCTTTGATTTCCTCTAACT
TAATTGTCCCTATCCTCCCCTCACCTCCGAGCTAGAGCTCACAGAATAAA
CAACAATCAAGAACCCCAACCAAACCCGACAACCTCAACTTCGCATTCCG
GTACCCTAGCGCACGAAACGCATATCATAATGAGCCACCCTCTACCCACC
AAAAGACCGCGAATCATAAGCTTTCTTGAGAGTGAGACGATAGCCTTGGA
AGGTACGGATCTCGCGAAGGTTTATGTGCACAGAGAGCTGTTGAGTGAGC
ACTGCGGGGCGGGCGGTGATTGTTGGTGGAGTTGTTTCCACAGCGACACG
ATTAAACGGCTCGTCGAATATCTCTACCAAGGGGACTATACTGGCCCTCT
GCCAGTTTCTGTCCCTCCGGTTACTCCTGCGAGCACGGTATTTGGCGAAG
AAGCTACGCCATTGGCCACGGACAGCCTTGTTTATTCCGGGTCTCTCGAC
TACGAAGGGGTCTTGCTCGGCCATGCTGAGCTATTCATACTTGCGAAGAC
TCGGAAGATTGGTACCCTTGCAAAGCTATGCCTCGCAAGGCTCTTCGAGA
GTATGAGTCGGGCTGAAGCTGAACAGACGGACTCCACGTTCTCAGAAAAC
ATGGTTGAATTACTTCGATACTCCTACAGTCACTGCTACATGAATGACAG
CTGTGCGTGGGGGGAACTTCAGGAGATCGTCTCCAACGCCTGGGTGGAAA
GAATAGAGTGGATTCTTGAGATGCCGGGCTCCAGTTTGCTCAGCGGCGAA
GGAAAACTAGTGAAGGATCTCATGATCGGAACAGTCAAGCGTCTTATAGA
CGCTGATAGCCGTTGTGGTGCTCAGGAGGGAAGTGAAGAATCGGTAGTTG
AAGAACCAGTTGCAGCACCCCAGCAGGGATATAATGGGCCAAATTTGTTT
GGGAATCCAGGGGGAAAGAACTCCGGAGTTGGCCTTTTCGCCAATCGTGG
TGACATCGGGGAGAATCGCCCAGGGAATGCTTCCCACATCTTTGGGGCCT
CTTCCAACACAACTACGCCTATTGCGTGGGGAGGCTCTACCT

Sequences in the Contig:

SY0AAA11YI22FM1 SY0AAA29YF17FM1 SY0AAA34YP01FM1
SY0AAA35YK03FM1 SY0AAC51YM24FM1 SY0AAC55YH14FM2
SY0AAD63YN21FM1