Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4199
Length(NT) : 467
Best Gene Model Blast : Link to GSTUMT00009196001 E-value : 2e-33
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4199
TTGGAGAAGGGGCTGCTCGTTCAGAAGTGGAAGGGGACGAAGACATACAA
TGGGGGGCACTGCGCGGTACTTGCGGTGCTGTATCATGGTTTGCTTAGTG
GCGCTCGGAGGGGGTTTTTCTGGTCGGAGCATTCTTGTGGCAGAGCGTGA
ATGCACATCCTACCAAGACTTGAACGCGTAACTTGACTCTTCTCACTTCC
TGCTTCGTGATGCGAGTTGGGCCTCTCGGAAGGACGGCAGCAACCATTTT
GAAAAAGGTGGGCGGAGATGACGCTACTCGTACTGTAGCAGCTGGCTCGA
GTAGAAATTGGCTTGAGCCCCTGTAAGCAGTTACAGTACGAGTACTCGAG
TAAATTAATGTCTCTACCATCAAGTTACCGGTGTCCCCGGGCAACGATGA
GCTGCACTTCTTCCAGACCAGCCAGCAGTCCTTCCCTCCCGACCAGCAGG
TCCTCTTCTGGGGGCCT

Sequences in the Contig:

SY0AAC27YF08FM1 SY0AAC38YJ24FM1