Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4197
Length(NT) : 1224
Best Gene Model Blast : Link to GSTUMT00010199001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SNOG_13711
Accession: ref|XP_001803918.1| Score: 301 E_value: 2e-25
KEGG Definition: diacylglycerol O-acyltransferase (DgaT), putative [EC:2.3.1.20]; K00635 diacylglycerol O-acyltransferase
Accession: afm:AFUA_2G08380 Score: 266 E_value: 1e-21
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4197
TTGGCTAGGGAGAGGTTTGACCAATAATCTTTTTCCTCTCTTTTCTATCG
TATTTCCCTCTTTCGCTCTCATGAGTTCGCCAATATCATACCTCGATATA
TGTGGGGCTGAGGCACATCTTTGAAAAGGAGCCACTCAAAAAAAGAACCG
GCCCGAGGAGTTATATACCTTTGATGCGGTAATCGGTTCCTTCCCAACTC
AATCTTTGAACACCAGCAAGTAAGGCACAAGCCACTTATTCCGGGAATTC
CATGATAGATCTATTATACTGTGCTCAAATGCTCGGGCACAGGCTTAAGA
TTTGTTCTTCTCCCAACCCACATTCCTATTTGTGGGCTTTTATTTACTCC
ATTTTGGACCCTCCCCTCGTCCTCCCCCTCAATTCATTCCTTCTTTTCCC
CCTTCATTGACTCCCCCTCCACACACACACCCTCTCCCTATTCCTTGACC
TCTCCTCCTTGCCTTCTTCTTCCGTTGCCCCCTCAATTAGATCTTCCAAG
CAATTGCCCTTTCTTGTTCCCCTTATCCTCCTATTCCTCACTCTTTGCCC
TTCCCCCACTCAGCTTCCTTCCTTCCTTTGATCTTTCCACAACATTGCAC
TCGCTATCAGCTTCCTAATTTTCAACCCCCCCTCTCTCTCCCATTTCCCA
ATTGCTAAGTCTCTTTGCCACAACTGTTCGTTGGCCATCTGCCGCGCGTC
CAGGGAAACCTCAGGATGACGTCTGTATCCGCAACGTCTACATCCACGTC
CACTTCCGTCTCAGTCGCACTTAGCTCGGATCCTACCCCGAGCCAAACCA
GGCGTTCCACATTTCCATCTGCAACAGCATCCACCCCCCCACCACAATCC
CCACACGAAGTAACCTGCCGGTCGAATGGCTATCACAGGAACCAGAAGAA
GCCAAAAGACTCGCCAGAATGGCGACAAGTACAAACACGCGTTTGCAGTG
CATTCGATGCCCAGGACGTCCACGCTGTCTCACGACTCTGTCGACACCCC
TTCCTTCATTGGCTTCCGAAATTTGATGGTTCTGGTTCTGATTGTGGGTA
ATCTGCGGCTCGTTATTGAGAATTACATGAAGTATGGTGTTCTTGTGCAC
ATTTCTGGAGCCGAGTTCCGGAGAGATGACTTGAAGATGTTTTGTCTTCT
CTACTGCTTGATTCCCGCCCACCTATTTGTTGGTTTCCTGATCGAGTTCA
TTGCCGCATACACTGCGCGCGGGG

Sequences in the Contig:

SY0AAA10YM20FM1 SY0AAC27YE13FM1 SY0AAC27YM20FM1
SY0AAD52YM06FM1