Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4195
Length(NT) : 801
Best Gene Model Blast : Link to GSTUMT00009297001 E-value : 1e-129
Numbers of ESTs : 13

Blast Results:

Nr Definition: hypothetical protein SNOG_15497
Accession: ref|XP_001805643.1| Score: 131 E_value: 5e-06
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4195
TTGGAATGTCTCTCCCTGAGTTCTTGATCCGTCACCCACCCACTCATTGT
GTTCCTGATTTTTTTCCCGCGACCACAGGTTTGAGCAAAGAAACCCTCAA
CTCGCCCCTGCATCTATATAACCCCCCCCCCCTTTCTTCCCCAACCTCTG
TCAGTTTCCGGGTTAACAGTGAACCTTACATACTCGGACCCACAAACCTG
ATAGCGACAAGATAAGGAAGCTATGACTTTTCACCTGACAACACCAAGTC
CGCACAACTCGACTCCTAGTAGCTCAACCACCAACAGTACGCCCGCGTAC
GGAAGTCCCCAACATGGCTCGCCAACTCAGTCAAGCTTTCCTACCTTTGA
TGGCCCTGGGGAAGACGGCCATTCCGTTGCGGAGAGCAGGGTTTTAATAA
TCATGACAGGAGGGACGATATGCATGCGTATGGGAAAAGACGGTTACGTT
CCCGTAAGTTTGCGTTCCCCTTTTTCCTTTTCCCTCTCTTGTGGTCCAAC
CGAAAATACTTTTGGTGATGGTGTTGCGTCATGGCATTGGCAACATGGAT
TGGAAATTCGCAATGAGCTGCCTTGGAACAATTGTTGTTGTTCCCTGGAG
GAGAAGCGCCCGTCGCTCCACAAGACTGTGAGCTGGGCACGCCACTGGCT
TTCTCGATGCCTATCTCAAACCCAGGCCGTCTTTCAATGATGGCTCGCCT
ACTAAATGTCTTCCTGTCATGACTGATGACGAGACGGAAGTGATGCTCGA
ATCTTTGCGCACCCCTCCTTCCAAACATGCTCGCCGCATTCGATACGCAA
T

Sequences in the Contig:

SY0AAC21YE03FM1 SY0AAC25YC08FM1 SY0AAC26YA12FM1
SY0AAC27YE02FM1 SY0AAC29YJ08FM1 SY0AAC39YP18FM1
SY0AAC55YJ06FM2 SY0AAC5YM11FM1 SY0AAC5YO21FM1
SY0AAD22YI20FM1 SY0AAD34YL14FM1 SY0AAD47YK11FM1
SY0AAD58YM13FM1