Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4192
Length(NT) : 625
Best Gene Model Blast : Link to GSTUMT00004251001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0147 Score: 216 E_value: 1e-18
PFAM Definition: DUF1777, Protein of unknown function (DUF1777). This is a family of eukaryotic proteins of unknown function. Some of the proteins in this family are putative nucleic acid binding proteins..
Pfam Number: pfam08648 Score: 160 E_value: 4e-12

Sequence:
>Contig4192
TTGGCAGCGTTTTGATCATCCACAGCCTTACGCCCTTCTAACAGTCATAG
GGATATCCTATTTTCTCCTTCGACAACTCTGTTCACTTTTGGTTTCTGCC
GGACTGATATTCTATCCGAATATTCATAAGAAAGCAACCTGATCGTCACG
ATAGTGCTGCTTCTACTCCGAGGCCCGACCGCAACGGCGGCGGGAGCGTT
AAATCTTCTTCTTCTAGAAGGGACCGAGACGGCGAACGAGACAGAGACCG
CGATAGAGACGACAGAAGCCCGCGTAGTGAACGCCATCGTGAACGCAGGA
GAAGCAGAAGCAGGGATAGCGATAGACGCCGTTTAGGTCGTAGAGATTCC
TACTATGATGGTGATGAATACTATGAGTCTTCATCTCGATACAGCAGGCA
CCGCTCCTGCGAAAGGGATGATGACAGGTATTACTCTGGACGCGGTCGAG
ATCGCAGATATAGGGATTACTACGACGAGCGTGACAGAGATGATTATTAC
AGAGGAGATAGGCGTGACCGTGATCGAAGATCAAGGAGTCCAAGGAGGCG
AGGTGGCCGAGGAAGGACTAGGTCTCGCTCTCCTCAGTTGACTGAAGATG
AACGCGATCGTCGTACTGTCTTTGT

Sequences in the Contig:

SY0AAC27YD16FM1 SY0AAC37YN02FM1