Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4191
Length(NT) : 1768
Best Gene Model Blast : Link to GSTUMT00000108001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein MGG_08202
Accession: ref|XP_362619.1| Score: 201 E_value: 1e-13
KEGG Definition: hypothetical protein
Accession: mgr:MGG_08202 Score: 201 E_value: 6e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4191
TTGGCTCCCCCAGCGCCGAGAAAGGGCTACACTTTTGCGGGGGAGATGGA
GAAGACATTTCACATTTCCCCATTCAACCATCGCTCGGGAAGTTACAACA
TCCAGGTTCGGGATCCTCTCGACACTGCCTCCCCCGCGGCATCCGGAGTG
GATATGCATATGGTTGTGATTGCTAGAGATGGTACGAAGAGTATGGTTGC
AAGAGCATTTTCCGTATCCCCCTCCTTCGATATGATCAACGGGGGCACTT
GTCAGGGGTTGGTTATAGCGGCAACGTGGGGCTACAATACTTTCTTAGCT
GTCCCTTGGACAATGTGGGAGGCGTGGAAGCTATACAGGAAGAAGGCTGT
TGTGTATACCCGACCCGAGGTTCTGCCAGGAAGCGGGCAGCGGGAAGCTA
CAAAATCTGAGAGGGATATGCAAAGGTTGTGGCTAGATTACTTTAAGCAC
AGAGTATCGACATACAACCTTCCAATCTCAGTAACAGTTACTCTACCGGA
ATCGAACGCAACTAAGGCAGCGGAAAATGTGACATTCTACTCAGACCAGC
TGAGCCGAGGTGTTTCCCCCGCACAAGCCGGGGCTTCGGACTCACAAGGA
CAACCTCCGCCTTTTGGGGAACTAGATGCACCATCGCTATCCAACACAGC
GAAATCCCACCTAACGATCCGCGTCTCCAACCCCCGTTTTTTCACACGTT
TCTTCTCACACCAGGATCCTCTACAAACAATATACTTAGACATCATATCC
CAGCCAGACGAGCGGCGTCTAGCGGTGGTAAATAACTTACCACTATTCCA
GGACCTTCTCCACCCCCAACCAAAAGCAACATCAATACTAAAAAACAGGC
AACCCCCCATCAAATTCGGCCCGTTCAACATAATTCCCCGTCTCCGACGT
CTAAAGACGTCACTAGAGTTGTCATCCCTCAGGTCGGACGAGGAATCTCT
AATCCGACTCTACCCTATATCCCACCGAAGCACGTTGGACGAATTCTTCC
GGACAAGCCGCAGGTGCCGGAGAAATTGTATGAAGGCGGTACTGGTCGAC
CTGATTGCCTTTGGGGAAGCCGAGAGTCTGGACCTCTACGAGAAGGTACT
GGAAGTCGGTATCTGGAGTGTGTCAATCGGCTTGACCGTCTCGCTCGTGG
CATCAATGCAACTTGATATCGGGGGACTTGCCGGGCTCGGAGGCACCGTG
TGGAGCTCCCTCCCGCCATTTTCGTGCCCTTTGTCTTGGACCGTTCCCGC
TGACCTTGCGGGAGTTAATGCTCCTCTGCTATGGGGTGCTGCTAAGGCTG
TGTTCTAACAACGGTCACTCCCGGATTGTTTTTATCAACCGTATACCATC
TCTTTGACTTGCGTGGCAGCGTGGCACGGCTGCTTTGCACCCATTGTGTC
GATATTCAATTCATTGTCTATCTATTATCCTATTGTTCTTCTGTTCCTCC
TCTTCCATTTTTCTCCCTTTAAAATAGCGTTTCGAGTTTTTCTTCGGGGA
TTTTTACCCTTGTGAATATTTCTTTCATCAAAAACGGCGGTCATTCTGCA
TCTAGGGGTTCATTTCATTTTTATTATTATTATTTTTATTATACTTTATT
TTGGGTTTTAACGTTTCTTTTCTTTTTTTCTTTTTTTTCGCGAACCTAGG
GGCCCGGAAATGGCAGGACGGTAAGGAGATTCCTTTTTAAAAAAAGATCA
TTATTCATCAAGGATTAAGGTTATAACGTTTAATCTTATTTTTCTTTTCT
TTTCTTTTCTTTTCTTTT

Sequences in the Contig:

SY0AAA48YE07FM1 SY0AAC1YL15FM1 SY0AAC27YD15FM1
SY0AAC62YD13FM1 SY0AAD47YE23FM1