Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4190
Length(NT) : 1822
Best Gene Model Blast : Link to GSTUMT00011735001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SS1G_03768
Accession: ref|XP_001595679.1| Score: 499 E_value: 4e-48
KEGG Definition: hypothetical protein
Accession: fgr:FG06111.1 Score: 419 E_value: 3e-39
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0752 Score: 176 E_value: 2e-13
PFAM Definition: No Hit Found
Swissprot: Q03327|UGO1_YEAST
Gene Ontology:
GO:0005741 = Cellular component: mitochondrial outer membrane
GO:0005515 = Molecular function: protein binding
GO:0030447 = Biological process: filamentous growth
GO:0008053 = Biological process: mitochondrial fusion
GO:0000002 = Biological process: mitochondrial genome maintenance

Sequence:
>Contig4190
TTGGCCACCACCACCGCCAGCACCACCGCCACCACGATTTGCACCGTTAC
GGACCACGGGCCCTTTACGAGTAGACTAACACCCACAAAACAAGAGAGGG
AAAAAAAAGAGGAGAAAAAAAAAAGATCAATCTTATCCCCACCTTAAATT
CTGCCCCTCCCTCTTCTCTCATTCCTCCTCCTCTCCTCCGTCCCCACCCC
ACCCCCCCTTCATTAATCCCTCCCTCCCGGCATCGAAAGGAGCACAGGTT
AGGTTCGGTAGACGAAAAAACGAAACGTAACGGAACAACTCCCACCTGGT
ATCATGTCGACACGGCAGGGCCCAAACCCACTACGACCATATTACATCCC
CTCACCCCCGATACCTCCACTCGACTCTTCGGCGCCAACACCAGCACCTC
TCCCCACTGCGTCATACTCGTATCCACCCGCACCGACAGATTCGAGAAGC
GGTGGTAGCATACTGGCGGATTACTCGGAATACCTCGAGGATCAATCCCC
GAAAGAAGTTATCAAAGGATGGTTCCAGCAAGCTGCAGTACAGTACTCTC
TGCAACTAATTGGTCTGCCGTTCGAGAATTCCCGGACCTTGTTACAATGC
GGGGCTGTGCCAAAGGGGGCTGGGAAGAGGATTGTGGAGGAGAACGAGGA
GGATGTCGATGATTATGCAAGCGATGATTCGGACCCGCCCTACTTTTCGG
AGGACGTTGAGGAGGAGCTGGACAGAGGTGGAGTCCCGCGGATGCGGGGC
GTGCAGAAGCCGCCTAGTGGTATGACGGGTAGAGCTGGGCACGTTATCGG
TGGGGGTCAGGGGGGCCAGGAAGTGCGGCCGCTGTGGATGCTCGAGACTG
TACAGGGACGGGTGAACACCGTGGGGGAGATGCTGAGAGCCTTATGGAGT
AAAGAGGGGTATTCAGGGATTTGGAAAGGTCAGAACGCAACGTTTGTGTA
TAACATTCTTATGCGGACGTTGGAAAGTTGGACGGGATCATTTCTATCAG
CGGTGCTGTCGCTGCCGGATCCGGGAATGGGGGAGATTGCGGACTCGGCC
GATCCGCTGGCGTCACTGGGTGTAGCTGTTGCAGCGTGCACTGTCACAGC
GCTAATTCTGGCGCCAATAGATATAGTCCGAACAAGACTGGTCATAACCC
CTCCAACCGAGCTTCCCCGCAATCTCCTCCCAAATATCCACCTCCTCCCC
TCCTACACCTGTCCACCCAACCTCCTCCTCCCCACAGCTCTCCACGCTGC
ACTCCCCTCCTTCATTTCTTTAGGGACCCCACATTTCCTCCGAAGCCGCT
TCGGCATAGACCCAATCGGGAACCCGACAACCTTCAGTTTAGTGACCTTC
CTATCCTCCACAGCGGGGCTCATCGTCCGGCTACCGCTTGAAACCGCCCT
CCGACGGGGCCAAGTCGCAGTAACAAAGCCGAAGAAGACTGTCGTTCCTG
TGGGAAGATATACGGGTGTGTTTGGAACAATGTGGTCCGTTGCAAAAGAA
GAGGATGGCGGGAGGTATGGCGTTGAGGGGCTGTATCGTGGCTGGAGGAT
GGGGGTTTGGGCAAACGTGGGAGTTTTGGGGCTGGGGTTGTTCGGTGTTA
GGGGGGAACCGGGGGAATTTTAACTTTTCTTGTCTTGAGCGGTATATATA
TTTTCTTTCTTTCCAAAAAAAAGCACCAATGGATGGATGAATGGCGGAGG
CGGAGGAGGAGGCGGATTGTACGTATATTGGAAGGATGATTGAGTGTGGT
GGTGGGTGATGTGGTTATCTTGACTACTTGCTTACACGCATCTGCGATGA
ATTTAATTCCCCACTCTTACGG

Sequences in the Contig:

SY0AAA54YM16FM1 SY0AAC19YJ11FM1 SY0AAC24YC18FM1
SY0AAC27YD03FM1 SY0AAC27YD03RM1 SY0AAC58YI23FM1
SY0AAD57YD11FM1