Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig419
Length(NT) : 606
Best Gene Model Blast : Link to GSTUMT00002686001 E-value : 1e-103
Numbers of ESTs : 13

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig419
TTGGTTGGCACGAAATCCATCTTATTACGCATCTCGCTCCTTAACTGAGA
CCACGAGTCCTCGACTCTCATGGAATTCTCGTTTCTATTTTGACCCCCTT
TTCCTTAACTTTTCATCTCTTCTCCTCCTCAATTCTCCCAACCCTTTCAA
GCCTCCGCAAGTCATAGGGGTCTATCTTAGTGCGGGCGCAACCTACGATA
GATGTCCTCTTGCGGATTGGGAAGTTGGGCTCGAGTGTGTGCTGTGGGCT
ACCCGTTTCGGGGGAATTGTCTTTCAAATTTTTTTTTTTTTGGCGATAAA
CGCAAATTCTTTTGCGGGTTGAAAGCCAATTCGATTCAGCCCCAGCACGC
AAGATCCCCACCCGGGGGAACCACCCATCACAAACCCTGCGAAACGTCAC
CTCGACTACGGACGGGAAGGCTACCTTACCCGCCAGCTTTTCCGTTGAGT
TTCGATTCGCATACCAACGTCTTGGGATAAAACCCTGGTTTTGAGGAGGA
GAAAGAAGAAGGGGGGGAAAAAGAAAGTCTTGTGATTTGTCGTCTAGTTT
TTTGCTTTTACGTAGCATTAAATGGTTAAAATGAGCGTTTTGCCAGTCTT
CTTTCT

Sequences in the Contig:

SY0AAA23YJ21FM1 SY0AAA60YH12FM1 SY0AAB12YP13FM1
SY0AAB1YG19FM1 SY0AAB27YF04FM1 SY0AAB38YE02FM1
SY0AAB3YL17FM1 SY0AAB41YH15FM1 SY0AAB43YP20FM1
SY0AAB46YL07FM1 SY0AAB54YA03FM1 SY0AAB8YK10FM1
SY0AAD52YI18FM1