Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4189
Length(NT) : 672
Best Gene Model Blast : Link to GSTUMT00003715001 E-value : 2e-80
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4189
TTGGCCACAATCTGAGATTGCTCAACGAAGAAAGGCTACCGACTGCCTAC
TAAGCAACTCCTTGGCCTTCGAATCCGGGCTGTCCTCGTGGGTTGGCTCT
TGGGGTCTTAGGAGGCTAACCGCTCTCAAATGGCACCTACCTTTATCAAT
GGATTGAATACTCTTCGCCCTCCTAGCGAAATATATGGGGCCGTTTCACC
GGACCAGACCTCTTGCCACCCTGGAGTTGGATTTCCCCCCGCAAGGCCTT
ATCTTGAGGATTCCCGCTTCCGGCCGTGAAAAAAGCCATGTTTGGATGCC
AAATATTAGGAGTGCCCAGGAAGTGTCACGCTGACCCATAGGAACCATAT
CGTCTCTGGTATTCCAGTACCTCTTGTCCCAGTACTGCTTGTTCCTTGCA
CCCGGGTATATATGGCCATTGTGTGAGCTTAAGGAAAGCCGGATGGACCA
TTCTCCATTTGTCGCTGCGAGCTGGACCCTATCTCTCGCCCTCCCTGGCC
TGCTCCCTCCTATAGTTTGGGATTTGGCCCATTCCCTGGATTCGAATCTT
CTAACAACTCACAACCTGCAGGATTTAGTGAAAATGGTGAGAAAGGGTGG
AAATTGGGGTGTTTTTTTGTTTTTTCTTTGAGGTCATGTACGGGGTACTC
TTCTCCTTACATTTTTTTTTCC

Sequences in the Contig:

SY0AAA16YC07FM1 SY0AAB16YE01FM1 SY0AAC27YC22FM1
SY0AAD62YG07FM1