Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4188
Length(NT) : 841
Best Gene Model Blast : Link to GSTUMT00002662001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4188
TTGGCTAATCACCCACAAAAGAAAAGCAGTTGACACAACAAAGCACCATG
CTCCGACTCATCTGTCAAGCAAGAATCACCTCCCCTACCCTTGTTCAACG
GATTGGGTTCAGAAAATTCGGCAATGAATTCATCCCCGATGACACAGAAC
ACGATAACAAACCTAACCACACAGCCCCGGAGAGTGTCGAACCAAAGGTG
GGACCCAATGGGGGTGGTAGTCAGTCTTATCTCTGGTGGGACAGAATGAA
TAGGTTGGATGTTAAAATTGATGGTGCTATTAAGGATCACGGAGAATTTA
AGGTCGATGTGACTAAAGCGATCGGAAACCTAGGACGTGAACTAGGACAA
GCGATAAACAATCTGCAGTCCGCAATGCAGTCCGAGATACACCAGGTGAA
GTCCGAGATACACCAGGCGAAGTCCGAGATGCAGTCCGAGATACACCAGG
TGAAGTCCGAGATGCGCAAGGAATTTGCGGATGTTAAATCCGACCAGAAA
GTTACCAAGTGGCAAGTCCACTTCTTATTTGTCGCATCATCATCGTTGGT
CTTATGGACTTTGAAAGACTACGTCCAACTTCGATTTCCAACCCTTTTCA
CGAAGGAAAAAGGAACCTCCCCCAAGCAGCCGGAAGCCCCCTGCGAGCAG
CCGGAAGCCCCCCAAAAGCACAAACAAAAGAAGCAGGCCTGGGCTTGGTA
GCTGTGTTGTTCCGGTATATTTGTATACACATGGCCTGATTATTGCAGGA
AGGGAATGAGATTGTTTCTTGATTGAAGTTTACTCTTCGGTTTGCTCCTT
GCCCTGTGTGGTAGAATTGCGGGGGAGTGGCTGTGGATACG

Sequences in the Contig:

SY0AAA27YG10FM1 SY0AAB16YK07FM1 SY0AAB27YB24FM1
SY0AAB34YF18FM1 SY0AAB49YL23FM1 SY0AAB4YP13FM1
SY0AAB9YF09FM1 SY0AAC27YC10FM1