Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4187
Length(NT) : 902
Best Gene Model Blast : Link to GSTUMT00000712001 E-value : 1e-100
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG08880.1
Accession: ref|XP_389056.1| Score: 282 E_value: 2e-23
KEGG Definition: hypothetical protein
Accession: fgr:FG08880.1 Score: 282 E_value: 1e-23
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1770 Score: 300 E_value: 4e-28
PFAM Definition: SUI1, Translation initiation factor SUI1..
Pfam Number: pfam01253 Score: 183 E_value: 2e-14
Swissprot: P79060|SUI1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4187
TTGGCGCATTCCCGTCCAACACACAAGCTATCACCGGCACAACACTACTA
CATTTCAAGTCCAAACCACTGCTCCGAAGCACCCAGAAACAGCTTTCCCG
CATACCCAACCCCCCTCGAAGTCTGTTTATGTCCATCGAAAATCTCAAGG
TTAATGATCCTTTCGCCGACGACGTTGGTGATACTCAGCCCAAGAATTAC
GTCCATATTCGTATCCAACAGCGCAACGGTCGCAAGACCTTGACGACTGT
CCAGGGGTTGTCTAAAGAATACAGTCCTAAAGCTCTTTTGAAAGCTTTCA
AAAAGGAATATGGTAATTATCCCCCTTCCCCACCATTCTGCTCGATTCGG
GGGCTCTGCCCGTCTGTCTTCCATATCGTTTAGGCAGGGCATCGATCTTG
CCCCTTGATTGTTTTGAGATAACGGAGGCGCTGACCTTGTGTTACCTCCA
TCGTTGCAGCTTGCAATGGCACTATTATCCAGGATAAGGACATGGGAGAG
GTGATCCAGCTTCAAGGCGATCATCGTACAAAGGTTATGGACTTCCTTAC
CGATAAAGGAAGCGACAAGATGGGCAAGTACGCACTTGCCAAAGAGAATA
TCAAGGTGAGCCATTTTCTTCGGAAATAATTTCCGGCAATTCGGTTGGAG
GCTCTGCTCACATGATATTTAGATCCACGGGTTTTAAGCCCTGCGTCTCC
AGCCTTCCTCAACACCGTTTACGTTGGTATTTGAGGAATGCTTTGCGCTG
GAAGACATGTGGGGTTTATTACAGTGTGCATGCTTGAGATTTCGGGGGTT
TGCAGTATACATACTTAATAAAACGTTACTCCAACGGATTCTGGCTGGAG
GGGGTTTTGTTGGTTGGTTGGTTGGTTGGTTGGTTGGGGGTGTGTTTTTT
TT

Sequences in the Contig:

SY0AAC27YC07FM1 SY0AAD21YM08FM1