Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4186
Length(NT) : 975
Best Gene Model Blast : Link to GSTUMT00004687001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE65930.1| Score: 374 E_value: 5e-34
KEGG Definition: predicted protein
Accession: aor:AO090010000010 Score: 374 E_value: 2e-34
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4186
ACAGTTATACTGGCCATACTGCGCCAACTTTTTTTATTTACTTCCAATCC
CAATCCTACAAACGTCTGTCCAATGTGCATCGTTGAGGTTGAAAATATTA
TTAAATGTAAAAAAAAGAAAGAAATTTTGAAATGAAAGAAACGTCCAATA
AGTTGTCCAATTCACCCACCCACCCTCGCCAACGTGTCTTGTTTTGTTGG
CTAGCCGGCAGGTTATGTATTCGAGCAGCGTGGCGGTAGGATCTATACAT
CTTTATCCTTCCCGGCATACAAATGCCCTATAATCGGCTGGTCCACTGGG
AGGCTCGACAGAAAGCAGTGGCCCACTTCCGGTTCTGCGGTGGAGCCCGA
CTTCGCTGGTACAGTGCCCCACATTAGCGGTTCATAAGATGCGTCCATGT
CGCCCTCTGGTGGGTGACATGCCGCTGCGATCGCAGCGGAGCAACTACCG
GCGAGTGGCATACCAAGGGGATATTTCTTCGAGCCGATGGCGAACAGGAC
TATTAAGTGGATTAGTCCGCTAACCATTAGCAACGCTATTCCTACCACAG
AGTATCCTACTGTGGAGACGACCTTAAAGGTCTCGCCGAGTGGACTGAAG
ACTTCGAACTTTGCCAGGAAAATTCCCTGTGATGCGCAAAGGTGGGTTAT
GGATTTCAGTGCCATTAGCGGTAGGGAGTATCGGTAGGGCAGCTGGAGCC
AGTACGTTGATCGCTGTTTGCCGATTGGCTGCGATACACGGAGTGGTTTA
CGCTTTATTGCAAAGTCCATCCATTCTTTGGCCATAAACATACTAGTGAA
TATGCCGTTGTAAGTTAGGTATAAGAACGATAGCACCACTTGCGGGGAAT
TGGCCAAGAATATCGGGATTATAAGTCCTCCATCCCTGGAGCTGAGAACC
GACGAAGTAGTTTGTGCTCCAAACCCATGCTTCACCAGCGACTTGATGTC
GGTTTCCTTGCCATTCCTTGCCCAA

Sequences in the Contig:

SY0AAA29YB22FM1 SY0AAA29YG17FM1 SY0AAC27YB08RM1
SY0AAC32YG15RM1 SY0AAD24YG10FM1 SY0AAD40YK02FM1