Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4185
Length(NT) : 359
Best Gene Model Blast : Link to GSTUMT00008228001 E-value : 5e-61
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4185
GGGAGGGAAAAAAGCAATTTTTGGATTGGATCTAGCTTATTGATGATTTA
CAAAATTTGTTTATCCATTATTGAGGTTTGGCCATCAAGGCTTTCGGGAT
ATGGATGGAATTCCCGTGGATCATTTGGACGGAAACTAGGCTACCGCATA
ACATAACATGCTGGACCAGACTAAAAAAGGGACAAAAGGGTGAGGGTAGA
AAGAAAAAATTAAGTAAAGCCCAGTGATCGGTGACCCGCCATTTAAAGCC
CGGTAATGACCAACTTCTTAGCACTAACGCCTTGGAAAAGGTCCTCAATC
GCCTTCTCCACCTCTTGTAAGCCACCACTGCGAACCTCGACCGGGGTCTC
GATGATGCC

Sequences in the Contig:

SY0AAC20YN01RM1 SY0AAC27YB06RM1