Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4184
Length(NT) : 804
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4184
TTGGCTCCCTTCCGCCCGTCCCCGCTTTAGGTGTTTGTTGGCCCTCCTTT
AGTTATATATATGTCCACTATGCTCTATCTACTCTGTAGTTGCGCCAACG
TTGCTGCCGAACCTCATCGTCCCCTCCATCACGTTACATAACAGCTTCCT
TAAGCATATTGTTATCATTTCTCCATTGATTCAAGTACTGATCCACTGTT
TAGTAATTTCATAGCGCATAGCCAGGCCTCCCACAGGTCGCCGACTTCAT
ATATTTCAGACCTTCTTCAGACCTTCTATCCAACCTCGAACTAGATATCG
AGTACGGTAGTCTCCTGCGGAGTCCATCCGACGCCGACTAGTGGAAATTG
ATTGGCTTTGCACCACCTTTTCCTAGTTTGATTCGCAAGTTTAGCCAAGC
TTACTACGGTGGTTAATAATAGTGCAGAAGACCAGTATAAAGCACGTGCA
ACTGCCCAAGAGGTTTCTACTTGAGCATTATCCTCTGGTGGTTGAATTTT
GACCCTCTCAACAAACCCTGTCGACGCGACTTTTTAAACCCCCGTCACCC
GAAAGGGGTGTAACGAAAACGAGGGAGATTTCCTGTTGTTCGTCTGTGCG
ATACAAGGGACTCCCGGACCTAGTGCTTTCTGAATCCTTTGCTGCACTGG
TAGCACTTTCCGCCACTAATAACCTGGCCTAGCTTGCTAGCCTACCATTT
GGATTGCTGGGTGCAAGCAGCTGAATACGCTTCTAGAACCCTACTCCTTT
AGGCTCTAGCACAGGATTGTTCCGCAGTCTAGACCGGGGCTCGATTGCCC
TACT

Sequences in the Contig:

SY0AAA53YH06FM1 SY0AAC20YF20FM1 SY0AAC27YA21FM1
SY0AAC44YG22FM1 SY0AAD36YA03FM1 SY0AAD55YP22FM1