Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4183
Length(NT) : 1004
Best Gene Model Blast : Link to GSTUMT00010877001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: ABC transporter
Accession: ref|XP_751019.1| Score: 279 E_value: 5e-23
KEGG Definition: ABC transporter, putative; K05776 molybdate transport system ATP-binding protein
Accession: afm:AFUA_6G11360 Score: 279 E_value: 3e-23
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0927 Score: 172 E_value: 3e-13
PFAM Definition: ABC_tran, ABC transporter. ABC transporters for a large family of proteins responsible for translocation of a variety of compounds across biological membranes. ABC transporters are the largest family of proteins in many completely sequenced bacteria. ABC transporters are composed of two copies of this domain and two copies of a transmembrane domain pfam00664. These four domains may belong to a single polypeptide, or belong in different polypeptide chains..
Pfam Number: pfam00005 Score: 128 E_value: 4e-08
Swissprot: Q9UT95|YL44_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig4183
TTGGTGCACCGATACTGTTTCCCAACACAACATTTGCCCTCCATCCCGCT
CAGAAATGGTCAATCCTTGGGTCGTCAAAATCAACTCTCCTATCCATCCT
CTGTGGTAGTCACATCGCTATCCCACCTACCGGTCGATGCTATCCCGGTC
TACGGGGCACCATTGAACTCGTCTCTTTCACCACTGGGAGCAAGAGTACG
GGGATGCTTGCTGGAGCTAACAGTGGGGAAACCTACTTGTCTGCACGGTA
TGAGGCTTGGAGGGAGGAATCTGATGTTTCTCTAAGGACGTGGCTGGGAG
GTAGTATTGCTGGGAAGAATCCTTTTGAGGAGGGAGGGGAGGTGAAAGGG
AAGGAAGCACTGGGGGAGAGGAAGAAGAAAGTGGAGGATGTCGCGGGAAC
CTTGATGCTACGGGAATTTCTAGATCAAAGTGTTATGACGTTGAGTAATG
GACAGAGCCAGCGGGCAAGAATTGCACAAGCGCTTTTGAAAAGACCGGAG
GTGTTGGCTATTGATGAGCCGTTTAGTATGGCTTCGTATGAACGGGTAGG
TGAGCCAGTGAGCGCTAATAATGACACGTAAAACAGTGGGACTCGATCCT
CCGTCTCGCAATTTACTATCAGAACTACTCTCCCGCCTCCCACGCGCCCC
ACAACCGACACAGATACTGCTCGGTCTCCGCCCGCAAGACCCTGTACCAG
CCTGGAGCACACACATAGCATTTATATCTAACAACCGTATCCTCGCGCAG
GGCCAAAAAGAATTCGTCATCTCGACCCTCCGTCGATCCGGAAAGACAAT
CCTACAAGAAGGCGACGACACCCAAAAACCCGCCCCAACCCTCCTCGACA
AAGTCTGGTCCGCCCCCGCGGTCCCGGCGTCCATATCACAAGATCGAATC
ACGCTGCCGTCAAAATCTACCTCCAGCCCAATTCTGATTCAAATGAGCAA
CATCCAAATAACATACCCCCCACACCCCCCCTTCCTACAGAACTTCTCCT
GGAC

Sequences in the Contig:

SY0AAC27YA10FM1 SY0AAC2YL01FM1 SY0AAC52YN12FM1
SY0AAC53YP06FM1 SY0AAD30YG07FM1 SY0AAD31YL24FM1
SY0AAD58YE06FM1 SY0AAD60YA07FM1