Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4182
Length(NT) : 1115
Best Gene Model Blast : Link to GSTUMT00000471001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_500375.1| Score: 242 E_value: 1e-18
KEGG Definition: hypothetical protein
Accession: yli:YALI0B01166g Score: 242 E_value: 6e-19
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q6CG37|CS111_YARLI

Sequence:
>Contig4182
TTGGGATAATATTATAAACAATTCATCTCGAATTACCCCACCACCCCGAG
CTCTTGATCTTCCCACCAGCTCCCCATCCTCCCCCTATTCTTTCGCCACA
GAGGTCGACAACCATTATCCACTACCGGCAGCTATCCTATTGGACTGATT
AGAGGTGTTGTCGTTGTTGTGGTGTGGGTCAGGATGGCTCGAAGAACAGA
TGACCCCCTCACTCTATCTCGGCGATCCAACAATCTTCAATTCTCATGTT
CCTCCTATTTTCAGTCTCCGTCTTCTCAACACTACACTCGTTCAATTTAT
CTTTACACGGACCCAAGATCCCTCTCCGCCGAGGCTAGCCGTCCCGTGAA
GAAACACCAGCCAAATTCCCCCATCAGTGATGCCCCTTCCCCCGTCCCGC
AGGGGCCGGCCGGATCTACCGCCCCGCAGTATACTCACAGGGCTATTTCC
TCTTTGATAACGCCGTATCTGGCGTCGAAGCCTGTAAAGCGCACGTCGAA
AAAACCAGCCCGCCCTCACAGCCTTTCCTCTTCGTCCTCATCGATACGTA
GCACCGCGAGTAGTATCCTTTCCAGAAAGCGCAAGTACTACTATGAGCAC
CCCAAGCTTTCCACCCTGCCCTCGGAGATCTTGGACGAGGTGTTCCAGCA
TCTAGACCAGGGCACTCTTCTTGCGCTCGCTAAGGTTTCCAGACGTATGT
TCGATGAAGTGGCGCACACATTATATGCCTCCCCGTCCTTTGCTTCCACA
CATCGCTTGGCCCAATTTGTTTCTGTGGTCTCGCGGAATAGGTTCTTGGC
CAAGATGGTGCGCAAATTGGATCTATCGAACCTGGGGTCCTGTGTAGACC
CAGACCTCCCATTGGCGGGATGGAGGGAATGGAAATTTCGCTCCTCCCAG
CTCTACACAATCCACCGGGACGACCCTCAAGACAGGAGGAAATCCGGTCG
GGTTAGAAGAAAGCTGCCTACACTGAAAACTAGCACTCACCCACTCCCCT
CGCCCCTCCTAAAAAAGTATTCTACCTCTAGAGATGTTCCTGTTGGCGGA
ATCATTCACATCCTTAGAGCTTGCCCCTACCTCCGCGAGCTGAACCTGTC
CGGCGTCCTGCTTGC

Sequences in the Contig:

SY0AAC13YC21FM1 SY0AAC26YP18FM1 SY0AAC37YJ01FM1
SY0AAC8YH21FM1 SY0AAD15YI05FM1 SY0AAD16YI07FM1
SY0AAD52YH13FM1 SY0AAD59YF21FM1