Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4181
Length(NT) : 667
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543333.1| Score: 561 E_value: 5e-56
KEGG Definition: hypothetical protein
Accession: ani:AN3547.2 Score: 510 E_value: 2e-50
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1840 Score: 299 E_value: 3e-28
PFAM Definition: No Hit Found
Swissprot: P46825|KLC_LOLPE

Sequence:
>Contig4181
TTGGGGCAGTTGGGAAGGAGATACTTGAGCTAGATAATTGAGACACCCTA
CAGAGTGTTAATAGCTCAGCTCAGCCAGTACGGAATATGAAAGGAAACGA
CGAAGCGGAGATTGTGTATCAACCTGTATCGGCGGGCAGAGAGAAGACCC
TTGGTCTAGATCATCCAGATACCATGCCAAGTATGGATAGTCTAGGCGTG
GCGCTATATAACCAGGGAAAGTACGAAGAGGCGGAGGTTATGTACCGACG
AGCATTGGCGAGCAGAGAGAAGGCACTTGGGCCAGATCATCCAAATACTC
TACAGAGTGTGGACAGTCTAGGCTCAACGCTGTACAACCAGAGAAAATAC
GACGAAGCGGTGGTTATGTATCGACGAGCATTGGCGAGCAGAGAGAAGGC
ACTTGGGCCAGATCATCCAAATACTCTACAGAGTGTGGACATCCTAGGCT
CAACGCTGTACAACCAGAGAAAATACGACGAAGCGGTGGTTATGTATCGA
CGAGCATTGGCGAGCAGAGAGAAGGCACTTGGGCCAGATCATCCAAATAC
TCTACAGAGTGTGGACAGTCTAGGCTCAACGCTGTACAACCAGAGAAAAT
ACGACGAAGCGGTGGTTATGTATCGACGAGCATTGGCGAGCAGAGAGAAG
GCACTTGGGCCAGATCA

Sequences in the Contig:

SY0AAC26YP17FM1 SY0AAC28YH06FM1