Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4180
Length(NT) : 601
Best Gene Model Blast : Link to GSTUMT00002033001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4180
TTGGGAACCCTCGCTGAGGGTTCACACGGTCTACCTCTCTTCACAATTCC
AAGCAGGAAGTATGGCTCTCAACTTGACACGTCAGTTGTGTTTTCAGAGA
TGCTTTTTTCACCCTCCTCGCTTCTATCCTCGCACTCATCCCACTCGCCA
CTTCACTAAGACTACAAAGAGAGCGATTGATGATGTTTTTGCCGAGGCTG
CTATTCCAAAGTCCGAAGGTACCCGAGTCCTTTCCAACCGAAGTTGCAAT
TCACCGAAAGGCTATTACTGATGGATTTACGGAAATTAAAGGGTGGATTA
AGACGATGATGGTGTTTGGCGGTGGAACTATTTTCTTCGGATTCGGATCG
CTTGCCTACAAAGTGATGGTGTATGACGTTGATGCCAAAAAAGAAATGAT
GGCACATACCGCACGTGTCGTCCACGAGTCGGAGGAGAGACTCCAGACCC
GCTTCGGTAGCCCCCTAGATAACTTTGAACAAAAAACCCAGGCCCAAATT
GAAAACTTGAAGCTTGAGACGAAGTCGGAGATTGACAAGCTCGGGCATTT
GGTCGAATTGTCTACCAAGAAACGCTAATGAGGCGCATTATTATGGGGGT
G

Sequences in the Contig:

SY0AAB35YA23FM1 SY0AAB37YN14FM1 SY0AAC26YP04FM1