Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig418
Length(NT) : 1198
Best Gene Model Blast : Link to GSTUMT00011007001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 609 E_value: 4e-61
KEGG Definition: hypothetical protein
Accession: ang:An12g05680 Score: 499 E_value: 1e-48
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 325 E_value: 8e-31
PFAM Definition: No Hit Found
Swissprot: Q5F478|ANR44_CHICK

Sequence:
>Contig418
TTGGCACCTCATCACCCCCCTCGCCACCTCTCATCATGCCCGAGCCTCAG
CTCAACAACGCCTAGAACGACAACTATCAGAACATGGACAGCAGCTCCAG
TACCACCCGACCGCTGGAATTGCCTCTCCGGAGGCCCGTCGATATCAACT
TGGCAGACTGGGGGCTCCGTACCCCGCTGAACTGGGCCGCTGAGGGGGGT
CACGAGGAAATAGTGAGGCTGCTCCTGAACCGGAAAGACATCGACCCCAA
CCTGGCCGATTACCGCGGCCGAACACCACTCATTGCCGCTCTGGAGAACC
GCCACGAGAATGTGGCCAAGCTCTTCATCGACCGGAAGGACTTCGATCCC
GAACCTAACCACGTTGATGCCTCGTTCCCGCTCGCGTGGGCTATCGATAT
GTGGTGCGAGGAGATAGTGGAACTGTTGCTTGCCCGGAAGGATATCGACC
CCAACAAGGGCGATTGCCGGGGTGGGCGTACCCCGCTGTGTCGGGCTGTG
ACTTGTGGGAACAAATATATCGTCAAAATGTTGTTGGATCGGGAAGGTGT
GGATGTCAATCGGGCGGGCATGCGAGGTCGGACCCCACTGTCTTGGTCTG
TTAACACGGGCTCCGCGGAAATGGTACGGCTCTTCTTGAGCCGTGAGGGA
ATCGAAGCCGATCTGGTTGATCGCAGCGGCCGAAGCCCACTCTCTTGGGC
CGCACAACAGGGGCATGTAGAGGTTGTGAAGCTATTGCTAGAACGAGAAG
ACGTCAGCCCAAACTCTGTGGACGCATTCCATCTTAAATCGCCACTCGCT
TGGGCTGCTAGTTTTAGCCATGGGGGGGTAATGAAGTTGCTGCTGGATCG
GAAAGACATCCAGCCCGATCTTGCTGATTCTAGGGGTCGAACAGCACTTT
CACACGCCGCTGCAAACAATTGCACAGAAGGAGTGAGGCTATTGCTAGCC
CGAGAGGATATCGACTCTAACTCGACGGATAGTGATGCACTCCACACGCC
GCTACTCCGGGCCACCGAGAATGGCAGCGCGGGAGCCGTGGAATTGCTGC
TACAACGGGCAGATGTCGAGCCGAACCGGGTGGATATCCAGAACCGAACC
GCGCTCTCCATCGCCGCTCGGAGCGGTCATGAGCTAATATCGAGAATGCT
TTTGGCCCGGGAAGATGTCGACCCCAACTTGGATAAACCAATTGTAGA

Sequences in the Contig:

SY0AAA10YF03FM1 SY0AAA23YJ19FM1 SY0AAA24YJ19FM2
SY0AAB1YF24FM1 SY0AAB52YL17FM1 SY0AAC17YC14FM1
SY0AAC2YA02FM1 SY0AAC60YD20FM1 SY0AAD21YM19FM1
SY0AAD44YG07FM1 SY0AAD58YD02FM1